Skip to main content Accessibility help
Hostname: page-component-79b67bcb76-6rw4p Total loading time: 1.171 Render date: 2021-05-14T11:41:02.941Z Has data issue: true Feature Flags: { "shouldUseShareProductTool": true, "shouldUseHypothesis": true, "isUnsiloEnabled": true, "metricsAbstractViews": false, "figures": false, "newCiteModal": false, "newCitedByModal": true, "newEcommerce": true }

Maternal supplementation of seaweed-derived polysaccharides improves intestinal health and immune status of suckling piglets

Published online by Cambridge University Press:  24 August 2015

G. Heim
School of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Republic of Ireland
J. V. O'Doherty
School of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Republic of Ireland
C. J. O'Shea
School of Veterinary Medicine, University College Dublin, Belfield, Dublin 4, Republic of Ireland
D. N. Doyle
School of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Republic of Ireland
A. M. Egan
School of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Republic of Ireland
K. Thornton
School of Veterinary Medicine, University College Dublin, Belfield, Dublin 4, Republic of Ireland
T. Sweeney
School of Veterinary Medicine, University College Dublin, Belfield, Dublin 4, Republic of Ireland
E-mail address:


The experiment investigated the effect of maternal dietary supplementation of seaweed-derived polysaccharides (SDP) (–SDP v. +SDP, n   20) from day 83 of gestation until weaning (day 28) on selected sow faeces and piglet digesta microbiota populations, piglet small-intestinal morphology, and intestinal nutrient transporter and inflammatory cytokine gene expression at birth, 48 h after birth and weaning. The effect of maternal dietary treatment on the piglet gene expression profile of inflammatory cytokines in the colon following a lipopolysaccharide (LPS) challenge was also investigated. Dietary SDP reduced sow faecal Enterobacteriaceae gene numbers at parturition. Small-intestinal morphology, nutrient transporter and cytokine gene expression in newborn piglets did not differ between maternal dietary treatments (P > 0·10). At 48 h after birth, sodium–glucose-linked transporter 1 gene expression was down-regulated in the ileum of piglets suckling the SDP-supplemented sows compared with those suckling the basal sows (P = 0·050). There was a SDP × LPS challenge interaction on IL-1 and IL-6 gene expression in the colon of piglets (P < 0·05). The gene expression of IL-1 and IL-6 was down-regulated in the LPS-challenged colon of piglets suckling the SDP sows compared with those suckling the basal sows (P < 0·05). However, there was no difference in IL-1 and IL-6 gene expression in the unchallenged colon between treatment groups. At weaning, piglets suckling the SDP-supplemented sows had increased villus height in the jejunum and ileum compared with those suckling the basal-fed sows (P < 0·05). In conclusion, maternal dietary SDP supplementation enhanced the immune response of suckling piglets and improved gut morphology, making them more immune competent to deal with post-weaning adversities.

Research Article
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (, which permits unrestricted re-use, distribution, and reproduction in any medium, provided the original work is properly cited.
Copyright © The Author(s) 2015

Piglets are born in an agammaglobulinaemic state( Reference Heim, Mellagi and Bierhals 1 ), due to the six-layered placenta of the dam( Reference Le Dividich, Rooke and Herpin 2 ). The gastrointestinal tract (GIT) of the piglet encounters numerous challenges at birth and weaning( Reference Zhang, Malo and Buddington 3 ). Immediately after birth, the neonatal GIT is rapidly colonised by bacteria originating from the mother or the environment( Reference Demecková, Kelly and Coutts 4 ). It has become clear that this primary colonisation is important for the right development and programming of the animal's local and systemic immune system( Reference Yao, Sun, Liu, Blachier, Wu and Yin 5 ). Furthermore, the GIT takes complete responsibility for the provision of nutrients, and shifts from processing amniotic fluid swallowed during and after birth to a nutrient-enriched colostrum ingested after birth( Reference Zhang, Malo and Buddington 3 ). At weaning, pigs are exposed to a large number of stressors, such as separation from the dam, transition from milk to a diet based on plant polysaccharides( Reference Maxwell, Carter, Lewis and Southern 6 ), and withdrawal of maternal IgA from milk that acts locally in the intestine of suckling piglets( Reference Salmon 7 ). These factors combined can disturb the intestinal immune system and microbiota equilibrium( Reference Kostantinov, Favier and Zhu 8 ), which contribute toward a decrease in daily gain immediately post-weaning. In order to adapt to the changes encountered at birth and weaning, the GIT undergoes accelerated tissue growth (birth) and functional maturation (birth and weaning)( Reference Xu, Wang and Zhang 9 ), characterised by increases in intestinal weight and length, villus height (VH) and crypt depth (CD), cell migration rate, RNA and DNA contents, and the adaptation of intestinal enzymic activity( Reference Rome, Barbot and Windsor 10 ). The intestinal epithelium is not only a physical barrier and a nutritional site; it also acts as a crucial regulator of intestinal immune homeostasis( Reference Takanashi, Tomosada and Villena 11 ). In response to bacteria colonisation at birth and weaning, the enterocytes can act as a component of the immune system by secreting cytokines( Reference Cario, Brown and McKee 12 , Reference Dibner and Richards 13 ).

Recent research has indicated that supplementing sows with seaweed-derived polysaccharides (SDP), containing laminarin and fucoidan, bioactives containing antimicrobial, prebiotic and immunomodulatory properties, from day 107 of gestation influenced piglet immune status at weaning, and had beneficial effects on weaning-associated intestinal dysfunction and growth depression immediately after weaning( Reference Leonard, Sweeney and Bahar 14 Reference Heim, Sweeney and O'Shea 18 ). However there is no information about the effect of maternal dietary treatment of SDP on intestinal dysfunction immediately after birth and after ingestion of colostrum. Furthermore, Leonard et al.( Reference Leonard, Sweeney and Bahar 17 ) found no effect of maternal SDP supplementation on piglet body weight (BW) at birth. The starting date of the supplementation (day 107 of gestation)( Reference Leonard, Sweeney and Bahar 17 ) may have been too late to promote an effect on piglet birth weight. Studies have been shown that the nutrient needs for fetal growth increase from day 69 of gestation( Reference McPherson, Ji and Wu 19 ), and the transfer of nutrients to the fetus increases between days 90 and 100 of gestation( Reference Biensen, Wilson and Ford 20 ).

Thus, the objective of the present study was to investigate the effect of maternal dietary supplementation of SDP from day 83 of gestation until weaning (day 28) on piglet BW at birth, and small-intestinal morphology, nutrient transporter and inflammatory cytokine gene expression, and colonic microbiota population of piglets at birth (0 h), 48 h after birth and weaning. The effect of maternal dietary treatment on the piglets’ gene expression profile of inflammatory cytokines in the colon following a lipopolysaccharide (LPS) challenge was also investigated. The hypothesis of this study is that maternal SDP supplementation from day 83 of gestation would improve piglet BW at birth and modulate selected intestinal microbial populations, the inflammatory response and aspects of intestinal health of piglets at birth and during the suckling period, making them more immune competent to deal with post-weaning adversities.

Materials and methods

All procedures described in the present experiment were conducted under experimental license from the Irish Department of Health in accordance with the Cruelty to Animals Act 1876 and the European Communities (Amendments of the Cruelty to Animals Act, 1876) Regulations.

Experimental design and dam diets – gestation and lactation period

A total of twenty crossbred pregnant gilts (Large White × Landrace genetic lines; Hermitage) were randomly assigned to one of the two dietary treatments (ten gilts/treatment): (T1) basal gestation/lactation diet (control) and (T2) basal gestation/lactation diet supplemented with 10·0 g SDP/d from day 83 of gestation until weaning (day 28). The quantity of SDP (Bioatlantis Ltd) used was based on previous work by Leonard et al.( Reference Leonard, Sweeney and Bahar 17 ). The SDP supplement (10·0 g/d) contained laminarin (1·0 g), fucoidan (0·8 g) and ash (8·2 g), and was extracted from a Laminaria spp. according to the procedure described by Lynch et al.( Reference Lynch, Sweeney and Callan 21 ). The gestation diet contained 140 g/kg of crude protein (CP), 13·5 MJ/kg of digestible energy (DE) and 4·4 g/kg of standardised ileal digestible (SID) lysine. The lactation diet contained 190 g/kg of CP, 14·5 MJ/kg of DE and 8·5 g/kg of SID lysine. All amino acid requirements were met relative to lysine( 22 ). The ingredient composition and chemical analysis of the diets are given in Table 1.

Table 1. Ingredients and chemical composition of the experimental diets (g/kg, unless otherwise indicated)

* T1 = basal diet; T2 = basal diet supplemented with 10·0 g seaweed-derived polysaccharides containing laminarin and fucoidan/d.

Gilt/sow diet provided (per kg diet): 250 mg choline chloride; 140 mg Fe; 120 mg Zn as ZnO; 67 mg α-tocopherol; 47 mg Mn as MnO; 25 mg Cu as CuSO4; 12 mg nicotinic, acid; 10 mg pantothenic, acid; 4 mg phytylmenaquinone; 2 mg riboflavin; 2 mg thiamin; 1·8 mg retinol; 0·6 mg iodine as calcium iodate on a calcium sulphate/calcium carbonate carrier; 0·3 mg Se as sodium selenite; 0·025 mg cholecalciferol; 0·015 mg pyridoxine; 0·01 mg cyanocobalamin.

Calculated from amino acid and digestible energy values of ingredients( Reference Sauvant, Perez and Tran 67 ).

Prior to day 83 of gestation, the gilts were housed in groups of ten. From day 83 until day 106 of gestation, they were housed individually in crates (2·0 × 0·6 m) in the gestation house. In the farrowing house, the gilts were housed individually in farrowing pens (2·2 × 2·4 m). The gestation and farrowing houses were maintained at 20°C throughout the experiment.

The experimental supplement (SDP) was top-dressed on the gestation diet and added to the trough prior to feeding the lactation diet each morning (09·00 hours) to ensure consumption. The dams received specific amounts of feed in the following quantities: 2·5 kg/d of gestation diet from day 83 until day 106 of gestation. They were fed 2·0 kg/d of lactation diet from day 107 of gestation until the day of farrowing and then the feed supply was increased by 1·0 kg/d until day 3 post-farrowing and by 0·5 kg/d until day 6 post-farrowing. Afterwards, the sows were allowed semi-ad libitum consumption of the diet, which was adjusted for each sow depending on daily intake. The sows were fed in three equal meals provided at 09·00, 13·00 and 17·00 hours. They had ad libitum access to drinking water throughout the experimental period.

On the expected farrowing date, fresh sow faecal samples (approximately 10 (sd 1·0) g) were collected from the ground into sterile containers (Sarstedt) and stored at −20°C for quantification (microbial genomic DNA analysis) of Lactobacillus spp. and Enterobacteriaceae.

Management of piglets and collection of colostrum samples

All farrowings were supervised. At parturition, piglets (Meat line boars × Large White × Landrace genetic lines gilts) were individually weighed and ear-tagged. Between 6 and 12 h after the birth of the last piglet, litter size was adjusted by cross-fostering piglets within sow dietary treatments to ensure that sows nursed a similar number of piglets (n 12 piglets/sow), and this was maintained throughout the suckling period. Cross-fostering performed on average at 20 h after birth has no adverse effects on growth performance( Reference Heim, Mellagi and Bierhals 23 ) and IgG serum concentration( Reference Le Dividich, Rooke and Herpin 2 ) of both adopted and biological piglets. The individual piglet BW was recorded at birth and weaning and the average daily gain calculated from these data. The piglets received an intramuscular injection of Fe-dextran (Ferdex 100; Medion Farma Jaya) on day 7 after birth. No creep feed was offered to the piglets throughout the lactation period, and piglets did not have access to the sows’ feed.

During parturition, approximately 30 ml of colostrum sample was collected from each sow after hand-milking the first pair of mammary glands. To facilitate colostrum sampling, piglets were removed from the sow, and milk ejection was induced after administration of 1 ml of oxytocin (Pitocina, Watson Laboratories Inc.) into the marginal ear vein of the sow. The colostrum samples were immediately frozen at −20°C before analysis for IgG concentration.

A diarrhoea score was recorded daily on litter basis from birth to weaning using a scale from 0 to 3: (0) no diarrhoea; (1) slight; (2) middle; (3) acute( Reference Stamati, Alexopoulos and Siochu 24 ). Diarrhoea score was performed by one trained person with no prior knowledge of the dietary treatment of the sows.

A total of sixteen piglets (n 8 piglets/treatment group, one piglet/sow) were selected at birth, with an average BW of 1·3 (sd 0·3) kg. The selection was based on the parturition of the third piglet. One trained operator was positioned at the back of the sow from the initiation of parturition, in order to make sure that the third piglet would not touch anything other than the sow vaginal tract and the gloved hand of the operator.

A total of sixteen piglets were selected at 48 h after birth (n 8 piglets/treatment group, one piglet/sow), with an average BW of 1·8 (sd 0·1) kg.

A total of sixteen piglets were selected at weaning (n 8 piglets/treatment group, one piglet/sow), with an average BW of 7·4 (sd 0·9) kg. The selection of piglets at 48 h after birth and weaning was based on the litter average BW.

The piglets were humanely killed on each day (immediately after birth (0 h), at 48 h after birth and at weaning) by lethal injection with pentobarbital sodium (Euthatal Solution, 200 mg/ml; Merial Animal Health Ltd) at a rate of 0·71 ml/kg BW to the cranial vena cava, and the entire intestinal tract was immediately removed.

Chemical analysis

The feed samples were milled through a hammer mill provided with a 1-mm screen (Christy and Norris hammer mill; Christy Turner Ltd). The gestation and lactation feed samples were analysed for N, DM, ash and gross energy as described by Heim et al.( Reference Heim, Walsh and Sweeney 25 ). The feed and dried faeces samples were milled through a hammer mill provided with a 1-mm screen (Christy and Norris). The DM of dried faeces and feed was determined after drying overnight at 103°C. Ash was determined after ignition of a known weight of concentrates or faeces in a muffle furnace (Nabertherm) at 500°C. The N content of both feed and faeces was determined using the LECO FP 528 instrument (Leco Instruments, U.K Ltd). Neutral-detergent fibre was determined using a Fibertec extraction unit (Tecator). The gross energy of the feed and faeces was determined using a Parr 1201 oxygen bomb calorimeter (Parr). The total laminarin content of the SDP supplement was determined using a Megazyme kit (Megazyme International Ireland Limited). Fucoidan levels were determined using the method of Usov et al. ( Reference Usov, Smirnova and Klochkova 26 ).

Collection of piglet tissue and digesta samples at birth (0 h), 48 h after birth and weaning

Immediately after slaughter, the entire intestinal tract was removed by blunt dissection and sections of the duodenum (10 cm from the stomach), jejunum (60 cm from stomach) and ileum (15 cm from caecum) were excised and fixed in 10 % phosphate-buffered formalin for VH and CD measurements. Ileum and colon tissues (second loop of the proximal colon) were excised, emptied by dissecting them along the mesentery and rinsed using sterile PBS (Oxoid). Two tissue sections of 1 cm2, which had been stripped of the overlying smooth muscle, were cut from each tissue. Then, one section from each tissue was placed in 1 ml of Dulbecco's modified Eagle's medium (Gibco, Life Technologies) in the presence or absence of bacterial LPS (source: Escherichia coli strain B4; Sigma Aldrich Ireland Limited) at a concentration of 10 mg/ml. Both LPS-challenged and unchallenged tissues were incubated at 37°C for 120 min before being removed, blotted dry and weighed. Approximately 1–2 g of the ileum and colon tissues were cut into small pieces and stored in 15 ml RNAlater® solution (Applied Biosystems) overnight at 4°C. RNAlater® was then removed before storing the samples at −80°C.

Colon digesta samples (approximately 2 g) were collected into sterile containers (Sarstedt) and stored at −20°C for quantification (microbial genomic DNA analysis) of Lactobacillus spp. and Enterobacteriaceae.

Colostrum IgG quantification

An assay for colostrum concentration of IgG was performed using a specific pig-ELISA IgG quantification kit (Bethyl Laboratories Inc.). For colostrum sample preparation, 10 ml of colostrum were centrifuged (15 min at 2500  g ; Rotanta 460 R; Hettich Lab Technology) and 10 µl of the defatted fraction containing the IgG were added into 990 µl of 1× Dilution Buffer B to give a 1:100 dilution. The serial dilutions were repeated until the dilution recommended for colostrum: 1:1 000 000. The IgG was quantified according to the manufacturer's instructions.

Microbiology – DNA extraction and quantitative real-time PCR

Microbial genomic DNA was extracted from sow faeces and piglet colon digesta samples using a QIAamp DNA stool kit (Qiagen) in accordance with the manufacturer's instructions. Quantity and quality of DNA were assessed using a NanoDrop Spectrophotometer (ND1000, Thermo Scientific). Standard curves were prepared as described by O'Shea et al. ( Reference O'Shea, Sweeney and Bahar 27 ). Briefly, genomic DNA from all samples was pooled and amplified through routine quantitative real-time PCR (RT-qPCR) using Lactobacillus spp. and Enterobacteriaceae primers. The primer sequences were as follows: Lactobacillus spp. – forward 5′–AGCAGTAGGGAATCTTCCA–3′ and reverse 5′–CACCGCTACACATGGAG–3′, 58°C; 341 bp and Enterobacteriaceae – forward 5′–CATTGACGTTACCCGCAGAAGAAGC–3′ and reverse 5′–CTCTACGAGACTCAAGCTTGC–3′, 58°C; 190 bp( Reference Metzler-Zebeli, Hooda and Pieper 28 ). All primers were designed using Primer Express Software (Applied Biosystems) and synthesised by MWG Biotech. Serial dilutions of these amplicons served to generate standard curves using RT-qPCR (ABI 7500 Real-Time PCR System; Applied Biosystems Ltd) permitting estimations of absolute quantification based on gene copy number (GCN)( Reference Lee, Kim and Shin 29 ). The RT-qPCR were performed in a final reaction volume of 20 µl containing 2 µl template DNA, 1 µl of forward (100 pm) and 1 µl of reverse primers (100 pm), 10 µl SYBR Green PCR Master Mix (Applied Biosystems) and 6 µl nuclease-free water. The thermal cycling conditions involved an initial denaturation step at 95°C for 10 min followed by forty cycles of 95°C for 15 s and 65°C for 1 min. Dissociation analyses of the RT-qPCR product were performed to confirm the specificity of the resulting RT-qPCR products. All samples were prepared in duplicate. The mean cycle threshold (C t ) values of duplicates of each sample were used for calculations.

Small-intestinal morphology

The preserved segments (duodenum, jejunum and ileum) were prepared using standard paraffin-embedding techniques. The samples were sectioned at 5 µm thickness and stained with haemotoxylin and eosin( Reference Liu, Piao and Thacker 30 ). Measurements of fifteen well-orientated and intact villi and crypts were taken for each segment. The VH and the CD were measured as described by Heim et al.( Reference Heim, Walsh and Sweeney 25 ). The results are expressed as mean VH or CD in μm. The VH:CD ratio was calculated.

Nutrient transporter and inflammatory cytokine gene expression – RNA extraction, complementary DNA synthesis and quantitative real-time PCR

RNA was extracted from approximately 50 mg of ileum and colon tissue samples using the GenElute Mammalian Total RNA Miniprep Kit (Sigma Aldrich Corporation) according to the manufacturer's instructions. The total RNA was quantified using 1·5 µl of total RNA on a NanoDrop Spectrophotometer (ND1000; Thermo Scientific) and samples with a 260:280 ratio ≥2·0 were considered suitable for complementary DNA (cDNA) synthesis. Total RNA integrity (i.e. quality and quantity) was assessed by analysing 1 µl of total RNA using the Agilent 2100 Bioanalyser version A.02.12 (Agilent Technologies, Inc.) using RNA Nano LabChips® (Caliper Technologies Corporation). The cDNA synthesis was performed using 1 µg of total RNA and oligo(dT)20 primers in a final reaction volume of 20 µl using a Superscript III First-Strand synthesis kit (Invitrogen, Life Technologies) following the manufacturer's instructions. The final reaction volume of 20 µl was then adjusted to 250 µl using nuclease-free water. All primers for the selected nutrient transporter (peptide transporter 1 (PEPT1/SLC15A1), sodium–glucose-linked transporter 1 (SGLT1/SLC5A1), glucose transporter 1 (GLUT1/SLC2A1), GLUT2/SLC2A and fatty acid binding proteins 2 (FABP2/I-FABP)) and inflammatory cytokine (IL-1, IL-6, IL-8, IL-10, IL-12A (p35), IL-17R, TNF-α, interferon γ (IFN-γ), transforming growth factor β1 (TGF-β1) and forkhead box P3 (FOXP3)) genes were designed using Primer Express (Applied Biosystems) and synthesised by MWG Biotech. Primer sequences are presented in Table 2. The nutrient transporter and inflammatory cytokine genes chosen were selected based on previous work by Heim et al. ( Reference Heim, Sweeney and O'Shea 18 , Reference Heim, Walsh and Sweeney 25 ). The efficiency of all primer sets was established using a semi-log curve of quantity v. control of 2-fold serial dilutions of cDNA as reported previously by Smith et al.( Reference Smith, O'Doherty and Reilly 31 ). The following porcine reference genes were used as described previously by Ryan et al.( Reference Ryan, Collins and O'Doherty 32 ): hydroxymethyl-bilane synthase (HMBS) and peptidylprolylisomerase A (PPIA) used for 0 h (immediately after birth) and weaning samples, and HMBS and tyrosine 3-mono-oxygenase/tryptophan 5-mono-oxygenase activation protein, zeta polypeptide (YWHAZ) used for 48 h after birth samples. The RT-qPCR was then carried out on cDNA using the ABI PRISM 7500 Fast sequence detection system for ninety-six-well plates (Applied Biosystems). All samples were prepared in duplicate using the SYBR Green Fast PCR Master Mix (Applied Biosystems), cDNA as the template and specific primers for the genes selected. For each reaction, 5 µl cDNA, 1·2 µl forward and reverse primer mix (300 nm), 3·8 µl nuclease-free water and 10 µl Fast SYBR Green PCR Master Mix were added and made up to a final volume of 20 µl. The two-step PCR programme was as follows: 95°C for 10 min for one cycle, followed by 95°C for 15 s and 60°C for 1 min for forty cycles.

The raw C t values for the reference genes were converted to relative quantities using the formula Q = E Δ C t where E is the PCR efficiency of the assay and Δ C t is the value calculated for the difference between the lowest C t value and the C t value of the sample in question for each gene. The relative quantities of the endogenous controls were then analysed for stability in geNorm( Reference Vandesompele, De Preter and Pattyn 33 ). The stability ‘M’ value generated by the geNorm application for the selected endogenous controls (β-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and PPIA) which was less than 1·5 indicated their suitability as endogenous controls for these intestinal samples. The geometric mean of the relative quantities for HMBS, YWHAZ and PPIA (normalisation factor) was then calculated using geNorm. The relative quantities were divided by the normalisation factor (obtained in geNorm) for that sample to give the final normalised relative expression for each target gene.

Statistical analysis

All data were analysed by using the General Linear Model procedure of SAS( 34 ). All data were initially checked for normality using the Univariate procedure in SAS( 34 ). Inflammatory cytokine and nutrient transporter gene expression in ileum tissue, small-intestinal morphology and Lactobacillus spp. and Enterobacteriaceae quantification data were analysed as a complete randomised design, with the piglet (sow pen) as the experimental unit. GCN of Lactobacillus spp. and Enterobacteriaceae were log-transformed before statistical analysis. Inflammatory cytokine gene expression in colon tissue data was analysed as a 2 × 2 factorial arrangement, with the piglet (sow pen) as the experimental unit. The statistical model used included the effects of maternal dietary treatment and challenge (LPS or PBS), and their associated two-way interactions. The sow lactation data were analysed as a complete randomised design, with the sow pen as the experimental unit. For piglet diarrhoea score, data were analysed by repeated-measures analysis using the PROC MIXED procedure of SAS. The model included the effects of maternal dietary treatment and time (days after birth) and the associated two-way interactions. The pdiff function of SAS was used to separate means. Simple regression models were used to determine the relationships between BW and small-intestinal morphology, between small-intestinal morphology and nutrient transporter gene expression, and between inflammatory cytokine and nutrient transporter gene expression. Animal (piglet) was modelled as a random effect. All data presented in the tables are expressed as least-square means with their standard errors. The probability level that denotes significance is P < 0·05, a numerical trend is P > 0·05 and P < 0·10, and not significant P > 0·10.

Table 2. Porcine oligonucleotide primers used for real-time PCR

F, forward; R, reverse; IFN-γ, interferon γ; TGF-β1, transforming growth factor β1; FOXP3, forkhead box P3; PPIA, peptidylprolylisomerase A; HMBS, hydroxymethyl-bilane synthase; YWHAZ, tyrosine 3-mono-oxygenase/tryptophan 5-mono-oxygenase activation protein, zeta polypeptide.


Sow reproductive performance, colostrum IgG concentration and suckling piglet growth performance

Gilts offered diet supplemented with SDP had a longer gestation period compared with the basal-fed gilts (114·5 v. 113·5 (se 0·27) d; P < 0·05). Colostrum IgG concentration did not differ between maternal dietary treatments; however, it did tend towards significance (57·0 v. 92·4 (se 16·9) mg/ml, for basal-fed and SDP-supplemented sows, respectively; P = 0·07). Litter size (14·4 (se 0·72) piglets) and the number of live born piglets (12·9 (se 0·62) piglets) were not influenced by maternal dietary treatments (P > 0·10). Piglet BW at birth (1·76 (se 0·66) kg) and weaning (8·33 (se 0·22) kg), and average daily gain from birth to weaning (0·24 (se 0·07) kg/d) (P > 0·10) did not differ between sow dietary treatments.

Diarrhoea score

There was a day effect on piglet diarrhoea score (P < 0·05; Fig. 1). Piglets suckling the SDP-supplemented sows had a lower diarrhoea score during the lactation period compared with those suckling the basal-fed sows (P < 0·05; Fig. 1).

Fig. 1. Differences in piglet diarrhoea score over time during days 0–3, 4–6, 7–9, 10–12, 13–15, 16–18, 19–21, 22–24 and 25–28 d post-birth. Diarrhoea score is measured on a scale from 0 to 3: (0) no diarrhoea; (1) slight; (2) middle; (3) acute( Reference Stamati, Alexopoulos and Siochu 24 ). (■), Group supplemented with seaweed-derived polysaccharides (SDP) containing laminarin and fucoidan; (♦), control group. Values are means, with standard errors represented by vertical bars. There were SDP (P = 0·010) and time (P < 0·001) effects. There was no SDP × time interaction (P > 0·10).

Sow faecal and piglet colonic microbiota population

Sows supplemented with SDP had reduced Enterobacteriaceae log GCN/g of faeces on the expected parturition day compared with those fed the basal diet (P < 0·05; Table 3). Sow Lactobacillus spp. log GCN/g of faeces did not differ between dietary treatments (P > 0·10; Table 3).

Table 3. Effect of maternal dietary treatment on selected microbiota gene numbers

(Least-square mean values with their standard errors)

SDP, seaweed-derived polysaccharides containing laminarin and fucoidan; GCN, gene copy number; LER, ratio of Lactobacillus spp. to Enterobacteriaceae.

* n 10 sows per treatment group.

n 8 piglets per treatment group.

Piglet Lactobacillus spp. and Enterobacteriaceae log GCN/g of colon digesta at birth (0 h), 48 h after birth and weaning did not differ between maternal dietary treatments (P > 0·10; Table 3).

Piglet small-intestinal morphology

The VH and the CD in the ileum showed a numerical increase from birth to weaning (VH average: 143 v. 406 µm, and CD average: 26 v. 126 µm at birth and weaning, respectively). Piglet small-intestinal morphology at birth and 48 h after birth did not differ between maternal dietary treatments (P > 0·10; Table 4). There was a positive linear effect of piglet birth weight on the VH in the ileum (R 2 0·53; P < 0·001) and jejunum (R 2 0·41; P < 0·01). There was also a positive linear effect of piglet BW at 48 h after birth on the VH in the jejunum (R 2 0·41; P < 0·01).

Table 4. Effect of maternal dietary treatment on small-intestinal morphology of piglets

(Least-square mean values with their standard errors)

SDP, seaweed-derived polysaccharides containing laminarin and fucoidan; VH, villus height; CD, crypt depth.

* n 8 piglets per treatment group.

At weaning, piglets suckling the SDP-supplemented sows had increased VH in the jejunum and ileum compared with those suckling the basal-fed sows (P < 0·05). Piglets suckling the SDP-supplemented sows had reduced CD in the ileum compared with those suckling the basal-fed sows (P < 0·05). Piglets suckling the SDP-supplemented sows had an increased VH:CD ratio in the ileum compared with those suckling the basal-fed sows (P < 0·05). There was a positive linear effect of piglet BW at weaning on the VH in the duodenum (R 2 0·35; P < 0·05).

Nutrient transporter gene expression

GLUT1, GLUT2 and PEPT1 are highly expressed at birth (relative abundance average: 1·38, 1·85 and 1·76 for GLUT1, GLUT2 and PEPT1, respectively), followed by a decline to the end of lactation (relative abundance average: 0·65, 0·41 and 0·43 for GLUT1, GLUT2 and PEPT1, respectively). The gene expression of FAPB2 and SGLT1 was lowly expressed at birth (relative abundance average: 1·04 and 0·83 for FABP2 and SGLT1, respectively), followed by an increase to the end of lactation (relative abundance average: 1·91 and 1·79 for FABP2 and SGLT1, respectively).

Nutrient transporter gene expression in ileum tissue of piglets at birth did not differ between maternal dietary treatments (P > 0·10; Table 5). At 48 h after birth, the gene expression of SGLT1 was down-regulated in the ileum of piglets suckling the SDP-supplemented sows compared with those suckling the basal-fed sows (P < 0·05; Table 5).

Table 5. Effect of maternal dietary treatment on the normalised relative abundance of nutrient transporter gene expression in ileal tissue of piglets

(Least-square mean values with their standard errors)

SDP, seaweed-derived polysaccharides containing laminarin and fucoidan; PEPT, peptide transporter; FABP, fatty acid binding protein; SGLT, sodium–glucose-linked transporter; GLUT, glucose transporter.

* n 8 piglets per treatment group.

At weaning, the gene expression of PEPT1, GLUT1 and GLUT2 was down-regulated in the ileum of piglets suckling the SDP-supplemented sows compared with those suckling the basal-fed sows (P < 0·05; Table 5). There was a negative linear effect of VH on GLUT1 gene expression in the ileum of piglets (R 2 0·36; P < 0·05).

Inflammatory cytokine gene expression in the ileum

Inflammatory cytokine gene expression in ileum tissue of piglets at birth and 48 h after birth did not differ between maternal dietary treatments (P > 0·10; Table 6).

Table 6. Effect of maternal dietary treatment on piglet ileal transcriptional response of genes related to the immune response

(Least-square mean values with their standard errors)

SDP, seaweed-derived polysaccharides containing laminarin and fucoidan; FOXP3, forkhead box P3; IFN-γ, interferon γ; TGF-β1, transforming growth factor β1.

* n 8 piglets per treatment group.

There was a positive linear effect of piglet birth weight on IL-10 gene expression in the ileum (R 2 0·41; P < 0·01). There was a negative linear effect of TNF-α gene expression on GLUT1 gene expression in the ileum of piglets at birth (0 h) (R 2 < 0·31; P < 0·05). There was a negative linear effect of piglet BW at 48 h after birth on TNF-α (R 2 0·36; P < 0·05) and IL-10 (R 2 < 0·38; P < 0·01) gene expression in the ileum.

At weaning, the gene expression of IL-1, IL-12A (p35), IFN-γ, TGF-β1 and TNF-α was up-regulated and the gene expression of IL-10, IL-17R, IL-6 and IL-8 was down-regulated in the ileum of piglets suckling the SDP-supplemented sows compared with those suckling the basal-fed sows (P < 0·05; Table 6). There was a negative linear effect of TNF-α gene expression on GLUT1 (R 2 0·51; P < 0·01), GLUT2 (R 2 0·41; P < 0·01) and PEPT1 (R 2 0·43; P < 0·01) gene expression in the ileum of piglets.

Inflammatory cytokine gene expression following an ex vivo lipopolysaccharide challenge in the colon

Inflammatory cytokine gene expression in piglet colon tissue following an ex vivo LPS challenge at birth did not differ between maternal dietary treatments (P > 0·10) (Table 7). The LPS challenge up-regulated the gene expression of IL-6, IL-8, IL-10 and TNF-α and down-regulated the gene expression of FOXP3, IL-1, IL-12A (p35), IL-17R, IFN-γ and TGF-β1 in the colon tissue of piglets at birth (P < 0·05) (Table 7).

Table 7. Effect of maternal dietary treatment on piglet colonic transcriptional response genes related to the immune response following an ex vivo lipopolysaccharide (LPS) challenge

(Least-square mean values and pooled standard errors)

SDP, seaweed-derived polysaccharides containing laminarin and fucoidan; FOXP3, forkhead box P3; IFN-γ, interferon γ; TGF-β1, transforming growth factor β1.

n 8 piglets per treatment group.

* Pooled sem.

** There was no SDP × LPS interaction (P > 0·10).

*** There was a SDP × LPS interaction (P < 0·05).

At 48 h after birth, there was an interactive effect between maternal dietary treatment and LPS challenge on the gene expression of IL-1 and IL-6 (P < 0·05) (Table 7). The gene expression of IL-1 and IL-6 was down-regulated in the LPS-challenged colon tissue of piglets suckling the SDP-supplemented sows compared with those suckling the basal-fed sows (P < 0·05). However, there was no difference in the gene expression of IL-1 and IL-6 in the unchallenged colon tissue between treatment groups (P > 0·10). The LPS challenge up-regulated the gene expression of IL-6 in the colonic tissue of piglets at weaning (P < 0·05) (Table 7).

At weaning, there was no maternal dietary treatment × LPS challenge interaction on cytokine gene expression (P > 0·10) (Table 7). The gene expression of FOXP3, IFN-γ and TGF-β1 was up-regulated and IL-6 was down-regulated in the colon tissue of piglets suckling the SDP-supplemented sows compared with those suckling the basal-fed sows (P < 0·05) (Table 7). The LPS challenge up-regulated the gene expression of FOXP3, IL-8, IL-10 and TNF-α in the colonic tissue of piglets at weaning (P < 0·05) (Table 7).


The hypothesis of this study is that maternal SDP supplementation from day 83 of gestation would improve piglet BW at birth and modulate selected intestinal microbial populations, the inflammatory response and aspects of intestinal health of piglets at birth and during the suckling period, making them more immune competent to deal with post-weaning adversities. The positive response observed in piglets suckling the SDP-supplemented sows, such as down-regulation of pro-inflammatory cytokine gene expression, and improved intestinal morphology in the ileum, partially supports this hypothesis. Dietary supplementation of SDP increased the gestation length. Gestation length of supplemented animals was prolonged by 1 d compared with the basal-fed gilts. The sow's gestation length is an average of 114 d, with 85 % of farrowing concentrating between 114 and 116 d of gestation( Reference Meredith and Meredith 35 ). Pig litters are unique: large litters at birth and the piglets are born relatively well developed. Much of this development takes place during the last few days of gestation( Reference Hakkarainen 36 ). It seems likely that prolonged gestation would improve piglet maturation at birth, as the nutrient needs for fetal growth increase from day 69 of gestation( Reference McPherson, Ji and Wu 19 ), and the transference of nutrients to the fetus increases between days 90 and 100 of gestation( Reference Biensen, Wilson and Ford 20 ). SDP contain sugars normally not present in plant dietary fibres( Reference Lahaye and Keaffer 37 , Reference MacArtain, Gill and Brooks 38 ). It was expected that these sugars, particularly laminarin, would provide nutrients to the fetus and consequently increase piglet birth weight. However, in the present study the increase in gestation length did not influence piglet BW at birth. There was also no effect of maternal dietary treatment on piglet BW at weaning. In agreement, Leonard et al.( Reference Leonard, Sweeney and Bahar 17 ) reported that sow dietary supplementation of a similar SDP from day 109 of gestation did not favour the growth performance of piglets during the lactation period.

Maternal dietary SDP supplementation numerically increased colostrum IgG concentration (P = 0·07). This is probably due to immunomodulatory property of laminarin( Reference Bourne and Curtis 39 ). Laminarin is absorbed from the ileum, as recent work by Heim et al.( Reference Heim, Walsh and Sweeney 25 ) showed that there was an increase in glucose transporters in the ileum following the ingestion of laminarin in weaned pigs. According to Bourne & Curtis( Reference Bourne and Curtis 39 ), all colostral IgG is derived from the serum of the sow. The IgG uptake from serum is then mediated by specific Fc-dependent receptors on mammary epithelial cells( Reference Huang, Hu and Hasler-Rapacz 40 , Reference Schnulle and Hurley 41 ). Previously, Leonard et al.( Reference Leonard, Sweeney and Bahar 17 ) reported that maternal supplementation of a similar SDP from day 109 of gestation increased colostrum IgG concentration.

Aspects of intestinal health and immune status

The intestine is a major site of digestion, nutrient absorption, harbouring a complex microbiota and a highly evolved mucosal immune system( Reference Takanashi, Tomosada and Villena 11 , Reference Lallès, Bosi and Smidt 42 ). In the small intestine, the nutrients undergo a series of degradative steps carried out by digestive enzymes( Reference Daniel 43 , Reference Van Goudoever, Corpeleijn and Riedijk 44 ) that can then be efficiently absorbed via nutrient transporters expressed along the crypt–villus axis in the enterocytes( Reference Daniel 43 ). Under conventional practice, abrupt weaning is often associated with undesirable morphological changes in the small-intestinal architecture, which include villous atrophy and crypt hyperplasia( Reference Cera, Mahan and Cross 45 , Reference Pluske, Hampson and Williams 46 ). There was no effect of maternal dietary treatment on nutrient transporter gene expression in the ileum of newborn piglets (0 h). There was also no effect of maternal dietary treatment on small-intestinal morphology. There was a positive linear effect of piglet birth weight on VH in the ileum and jejunum. Maternal dietary supplementation of SDP resulted in a down-regulation of the gene expression of SGLT1 in the ileum of piglets at 48 h after birth, and PEPT1, GLUT1 and GLUT2 at weaning. It is still not clear why maternal dietary supplementation of SDP down-regulated protein and glucose transporter gene expression in the ileum of suckling piglets. First, it may be related to an increase in VH in the ileum of these piglets. According to the regression analysis, there was a negative relationship between VH and the gene expression of GLUT1 at weaning. However, in this study, only the mRNA abundance of these nutrient transporters was measured, and unfortunately the nutrient transporter proteins were not measured. The expression of SGLT1 is tightly linked to the villus architecture( Reference Ferraris 47 ). Regulation of glucose transport by diet may involve increased transcription of SGLT1 mainly in crypt cells. As cells migrate to the villus, the mRNA is degraded, and transporter proteins are then inserted into the membrane, leading to increases in glucose transport about 1 d after an increase in carbohydrate levels. Endocrine factors regulate the development of intestinal brush-border enzymes during weaning, but do not regulate the development of intestinal glucose transporters( Reference Ferraris 47 ). The absence of regulation of glucose transport in suckling animals that nurse on milk is due to animals consuming a diet that does not vary in carbohydrate composition( Reference Toloza and Diamond 48 ). It is possible that SGLT1 in cells present in the small intestine since birth cannot be regulated, and dietary regulation begins only when these cells are eventually replaced. The difference in SGLT1 expression may have been due to difference in milk composition. Unfortunately, milk composition was not measured in this experiment. However, Leonard et al.( Reference Leonard, Sweeney and Bahar 14 ) demonstrated that sow dietary supplementation of a similar SDP altered milk composition during lactation.

Second, the down-regulation of PEPT1 gene expression in the ileum of piglets suckling the SDP-supplemented sows at weaning may be attributed to the up-regulation of pro-inflammatory cytokine gene expression( Reference Shu, Takeda and Shinzawa 49 ). This is supported by a negative relationship between TNF-α gene expression and PEPT1 gene expression in the ileum at weaning. According to Shu et al.( Reference Shu, Takeda and Shinzawa 49 ), bacterial infections alter PEPT1 expression level in the intestine. Furthermore, in the current study, a panel of pro-inflammatory cytokines was up-regulated in the ileum of piglets suckling SDP-supplemented sows at weaning. Third, the down-regulation of nutrient transporter gene expression may be attributed to the polysaccharide fucoidan. Heim et al.( Reference Heim, O'Shea and Doyle 50 ) reported that when gilts were supplemented with fucoidan, from day 107 of gestation to weaning (day 24), the gene expression of SGLT1 was down-regulated in the ileum of piglets at weaning.

The present data also show that GLUT1, GLUT2 and PEPT1 are highly expressed at birth followed by a decline to the end of lactation. On the other hand, the gene expression of FAPB2 and SGLT1 was lowly expressed at birth, followed by an increase to the end of lactation. VH and CD in the ileum showed a numerical increase from birth to weaning. Interestingly, there was a positive linear effect of piglet BW at birth on VH in the ileum. However, no maternal dietary treatment effect was observed on piglet BW at birth and VH in the ileum. In addition, maternal dietary SDP supplementation positively changed piglet small-intestinal architecture at weaning (increased VH and VH:CD ratio). The VH:CD ratio is a useful criterion for assessing intestinal health and function( Reference Pluske, Hampson and Williams 46 ). This increase in VH and the VH:CD ratio may be attributed to the reduced diarrhoea score during the lactation period. Reduction in VH and the VH:CD ratio have been associated with increased incidences of scouring in weaned pigs challenged with enterotoxigenic E. coli ( Reference Heim, Sweeney and O'Shea 18 ).

Immediately after birth the neonatal intestine is rapidly invaded by bacteria, originating from the mother and the environment( Reference Kostantinov, Favier and Zhu 8 ) and this primary colonisation is important for the right development and programming of the animal's local and systemic immune system( Reference Yao, Sun, Liu, Blachier, Wu and Yin 5 ). Dietary provision of SDP reduced dam Enterobacteriaceae GCN/g faeces on the expected parturition day, indicating an antimicrobial property of SDP. Previous research indicated that supplementation of a similar SDP to sows decreased their faecal Enterobacteriaceae numbers at parturition( Reference Leonard, Sweeney and Bahar 17 ). The reduction in sow Enterobacteriaceae GCN/g faeces may be attributed to the potential agglutination properties of the SDP. β-Glucans (laminarin) have the capacity to agglutinate certain bacterial species, thus inhibiting subsequent attachment and colonisation of epithelial mucosal surfaces( Reference Sweeney, Collins and Reilly 51 ). Furthermore, fucoidan possesses numerous biological functions, including antimicrobial properties( Reference Shibata, Iimuro and Uchiya 52 ). Demecková et al.( Reference Demecková, Kelly and Coutts 4 ) reported that sow faecal microbiota composition at farrowing influences subsequent bacterial colonisation of the neonatal intestinal tract. In the current study, lactobacilli were selected as bacterial indicators of beneficial bacteria, while Enterobacteriaceae were chosen based on their potential association with gastrointestinal disequilibrium( Reference Nyachoti, Omogbenigun and Rademacher 53 ). Piglets suckling the SDP-supplemented sows had reduced diarrhoea score during the lactation period. However, the decline in sow Enterobacteriaceae GCN/g faeces did not affect piglet Enterobacteriaceae GCN/g colonic digesta at birth, 48 h after birth and weaning. This reduction in diarrhoea score may be attributed to the immunomodulatory effects of SDP in enhancing the cellular and humoral immune function, as well as suppressing the E. coli population( Reference Leonard, Sweeney and Bahar 17 ). Leonard et al.( Reference Leonard, Sweeney and Bahar 17 ) demonstrated that sow SDP supplementation reduced piglet colonic E. coli numbers at weaning. A suppressed colonic E. coli number may ultimately alleviate the incidence and severity of diarrhoea. Unfortunately, E. coli GCN was not measured in the current study.

LPS is a component of the outer membrane of Gram-negative bacteria and a commonly used immunostimulant( Reference Medvedev, Piao and Shoenfelt 54 ). To mimic an immunological stress and the response of pigs exposed to a microbial challenge, colon tissue of piglets was LPS challenged ex vivo at birth, 48 h after birth and weaning. The biological effects mediated by LPS are attributed to inflammatory cytokine synthesis and release by stimulated macrophages( Reference Johnson and von Borell 55 , Reference Johnson 56 ). The LPS challenge up-regulated the gene expression of a panel of pro-inflammatory cytokines at birth (IL-6, IL-8 and TNF-α), 48 h after birth (IL-6) and weaning (IL-8 and TNF-α), proving the LPS challenge worked.

The colonic tissue of piglets suckling the SDP-supplemented sows, following LPS challenge had IL-1 and IL-6 gene expression down-regulated at 48 h after birth. There are a number of ways these findings could be interpreted. Porcine epithelial cells respond to various pathogens with the production of TNF-α and IFN-γ which block pathogen replication and cytokines are also involved in recruitment and activation of immune cells( Reference Mair, Sedlak and Käser 57 ). The fact that piglets suckling the basal fed sows displayed increased expression of IL-1 and IL-6 in response to LPS suggests that these animals retained a capacity to respond more adequately to infection relative to the piglets suckling SDP-supplemented sows. An alternative hypothesis is that piglets suckling the SDP-supplemented sows possess a number of inherent energy-saving mechanisms, one of which is exhibited as a reduced inflammatory response following infection, as a result of maternal feeding of SDP. While both pig populations had no differences in their pathogenic bacteria levels at 48 h, experimental infection would be necessary to establish if this reduction in cytokine expression results in a measurable decrease in their resistance to pathogenic bacteria.

At weaning, the gene expression of the anti-inflammatory cytokine TGF-β1 was up-regulated and the gene expression of the pro-inflammatory cytokines IL-6 and IL-8 was down-regulated in the ileum and colon tissues of piglets suckling the SDP-supplemented sows. IL-6 is produced by a number of cell types including macrophages, endothelial cells, B cells and mast cells, and is up-regulated in most, if not all inflammatory states( Reference Dalrymple, Slattery and Aud 58 ). IL-8 is known to be regulated by inflammatory signals( Reference Kasahara, Mukaida and Yamashita 59 ). IL-6 and IL-8 are cytokines classically involved in E. coli-caused diarrhoea( Reference McLamb, Gibson and Overman 60 ). Down-regulation of the gene expression of these cytokines may be related to the reduced faecal scores observed in piglets suckling the SDP-supplemented sows. If the maternal SDP supplementation suppresses the secretion of pro-inflammatory cytokines, this could lower the activity of the immune system resulting in an energy-saving mechanism and increased growth performance during the suckling and post-weaning periods, as suggested by Li et al.( Reference Li, Li and Xing 61 ).

There was a positive linear relationship between piglet BW at birth and the anti-inflammatory IL-10 gene expression in the ileum. IL-10 is considered a potent anti-inflammatory cytokine that strongly inhibits the production of pro-inflammatory cytokines( Reference Lauw, Pajkrt and Hack 62 ). There was negative linear relationship between piglet BW at 48 h after birth and gene expression of the pro-inflammatory TNF-α in the ileum, enforcing the concept of maximising piglets’ ingestion of colostrum and milk in the first 48 h after birth.

A panel of pro-inflammatory cytokines was also up-regulated in the ileum and colon tissues of piglets suckling the SDP-supplemented sows at weaning. However, this pro-inflammatory response did not affect piglet growth performance during the lactation period. These cytokines play an important role in acute inflammation and are responsible for neutrophil recruitment and activation to the initial site of infection( Reference Girard, Oswald and Taranu 63 ). β-Glucans can stimulate macrophages, neutrophils and natural killer cells, and could promote T cell-specific responses by induction of pro-inflammatory cytokines like IFN-γ, IL-8 and IL-12A (p35) from those cells( Reference Brown and Gordon 64 Reference Chaung, Huang and Yu 66 ). This pro-inflammatory response could be of particular importance because piglets often encounter presenting pathogens immediately post-weaning. Leonard et al.( Reference Leonard, Sweeney and Bahar 17 ) reported that maternal SDP supplementation enhanced the expression of TNF-α in the ileum after an ex vivo LPS challenge at weaning.


Maternal dietary SDP supplementation down-regulated the gene expression of a panel of pro-inflammatory cytokines, classically involved in E. coli-caused diarrhoea in piglets at 48 h after birth and weaning, indicating an important immunomodulatory effect of SDP. Maternal SDP supplementation also had positive effect in the small-intestinal architecture of suckling piglets, represented by the increased VH in the ileum of piglets at weaning. Even though little positive effect was observed in nutrient transporter gene expression and the microbiota population of suckling piglets, the results provide new insights into the protective activity of maternal SDP supplementation, making the suckling piglets more immune competent to deal with pathogens commonly encountered during the immediate post-weaning period.


This study was supported financially by the Irish Research Council for Science, Engineering and Technology (IRCSET) and BioAtlantis Ltd. The IRCSET and BioAtlantis had no role in the design, analysis or writing of this article. G. H. designed the experiment, wrote the manuscript, collected samples and carried out laboratory analysis. J. V. O’. D. was the principal investigator responsible for the design of the experiment, supervision of data collection and statistical analysis and correction of the manuscript. T. S. designed the study. C. J. O’. S. contributed toward designing the study and laboratory analysis. D. N. D. and A. M. E. helped with data collection. K. T. contributed toward laboratory analysis. All the authors approved the final version submitted for publication. None of the authors had a financial or personal conflict of interest in relation to the present study.


1. Heim, G, Mellagi, APG, Bierhals, T, et al. (2011) Absorption of IgG via colostrum in biological piglets and adopted piglets after cross-fostering. Arq Bras Med Vet Zoot 63, 10731078.CrossRefGoogle Scholar
2. Le Dividich, J, Rooke, JA & Herpin, P (2005) Nutritional and immunological importance of colostrum for the new-born pig. J Agric Sci 143, 469485.CrossRefGoogle Scholar
3. Zhang, H, Malo, C & Buddington, RK (1997) Suckling induces rapid intestinal growth and changes in brush border digestive functions of newborn pigs. J Nutr 127, 418426.Google ScholarPubMed
4. Demecková, V, Kelly, D, Coutts, AG, et al. (2002) The effect of fermented liquid feeding on the faecal microbiology and colostrum quality of farrowing sows. Int J Food Microbiol 79, 8597.CrossRefGoogle ScholarPubMed
5. Yao, K, Sun, Z, Liu, Z, et al. (2013) Development of the gastrointestinal tract in pigs. In Nutritional and Physiological Functions of Amino Acids in Pigs, pp. 318 [Blachier, F, Wu, G and Yin, Y, editors].Vienna: Springer Verlag.CrossRefGoogle Scholar
6. Maxwell, CV & Carter, SD (2001) Feeding the weaned pig. In Swine Nutrition, 2nd ed., pp. 692715 [Lewis, AJ and Southern, LL, editors]. Boca Raton, FL: CRC Press.Google Scholar
7. Salmon, H (1999) The mammary gland and neonate mucosal immunity. Vet Immun Immunopathol 72, 143155.CrossRefGoogle ScholarPubMed
8. Kostantinov, SR, Favier, CF, Zhu, WY, et al. (2004) Microbial diversity studies of the porcine gastrointestinal ecosystem during weaning transition. Anim Res 53, 317324.CrossRefGoogle Scholar
9. Xu, RJ, Wang, F & Zhang, SH (2000) Postnatal adaptation of the gastrointestinal tract in neonatal pigs: a possible role of milk-borne growth factors. Livest Sci 66, 95107.CrossRefGoogle Scholar
10. Rome, S, Barbot, L, Windsor, E, et al. (2002) The regionalization of PepT1, NBAT and EAAC1 transporters in the small intestine of rats are unchanged from birth to adulthood. J Nutr 132, 10091011.Google Scholar
11. Takanashi, N, Tomosada, Y, Villena, J, et al. (2013) Advanced application of bovine intestinal epithelial cell line for evaluating regulatory effect of lactobacilli against heat-killed enterotoxigenic Escherichia coli-mediated inflammation. BMC Microbiol 13, 54.CrossRefGoogle ScholarPubMed
12. Cario, E, Brown, D, McKee, M, et al. (2002) Commensal-associated molecular patterns induce selective Toll-like receptor trafficking from apical membrane to cytoplasmic compartments in polarized intestinal epithelium. Am J Pathol 160, 165173.CrossRefGoogle ScholarPubMed
13. Dibner, JJ & Richards, JD (2005) Antibiotic growth promoters in agriculture: history and mode of action. Poult Sci 84, 634643.CrossRefGoogle ScholarPubMed
14. Leonard, SG, Sweeney, T, Bahar, B, et al. (2010) Effect of maternal fish oil and seaweed extract supplementation on colostrum and milk composition, humoral immune response, and performance of suckled piglets. J Anim Sci 88, 29882997.CrossRefGoogle ScholarPubMed
15. Leonard, SG, Sweeney, T, Pierce, KM, et al. (2010) The effects of supplementing the diet of the sow with seaweed extracts and fish oil on aspects of gastrointestinal health and performance of the weaned piglet. Br J Nutr 105, 549560.CrossRefGoogle Scholar
16. Leonard, SG, Sweeney, T, Bahar, B, et al. (2011) Effects of dietary seaweed extract supplementation in sows and post-weaned pigs on performance, intestinal morphology, intestinal microflora and immune status. Br J Nutr 106, 688699.CrossRefGoogle ScholarPubMed
17. Leonard, SG, Sweeney, T, Bahar, B, et al. (2012) Effect of maternal seaweed extract supplementation on suckling piglet growth, humoral immunity, selected microflora, and immune response after an ex vivo lipopolysaccharide challenge. J Anim Sci 90, 505514.CrossRefGoogle ScholarPubMed
18. Heim, G, Sweeney, T, O'Shea, CJ, et al. (2014) Effect of maternal supplementation with seaweed extracts on growth performance and aspects of gastrointestinal health of newly weaned piglets after challenge with enterotoxigenic Escherichia coli K88. Br J Nutr 112, 19551965.CrossRefGoogle ScholarPubMed
19. McPherson, RL, Ji, F, Wu, G, et al. (2004) Growth and compositional changes of fetal tissues in pigs. J Anim Sci 82, 25342540.CrossRefGoogle ScholarPubMed
20. Biensen, NJ, Wilson, ME & Ford, SP (1998) The impact of either a Meishan or Yorkshire uterus on Meishan or Yorkshire fetal and placental development to days 70, 90, and 110 of gestation. J Anim Sci 76, 21692176.CrossRefGoogle ScholarPubMed
21. Lynch, MB, Sweeney, T, Callan, JJ, et al. (2009) The effect of dietary Laminaria-derived laminarin and fucoidan on nutrient digestibility, nitrogen utilisation, intestinal microflora and volatile fatty acid concentration in pigs. J Sci Food Agric 90, 430437.Google ScholarPubMed
22. National Research Council (2012) Nutrient Requirements of Swine, 11th ed. Washington, DC: National Academies Press.Google ScholarPubMed
23. Heim, G, Mellagi, APG, Bierhals, T, et al. (2012) Effects of cross-fostering within 24 h after birth on pre-weaning behaviour, growth performance and survival rate of biological and adopted piglets. Livest Sci 150, 121127.CrossRefGoogle Scholar
24. Stamati, S, Alexopoulos, C, Siochu, A, et al. (2006) Probiosis in sows by administration of Bacillus toyoi spores during late pregnancy and lactation: effect on their health status/performance and on litter characteristics. Intern J Probiotics Prebiotics 1, 3340.Google Scholar
25. Heim, G, Walsh, AM, Sweeney, T, et al. (2014) Effect of seaweed derived laminarin and fucoidan, and zinc oxide on gut morphology, nutrient transporters, nutrient digestibility, growth performance and selected microbial populations in weaned pigs. Br J Nutr 111, 15771585.CrossRefGoogle ScholarPubMed
26. Usov, AI, Smirnova, GP & Klochkova, NG (2001) Polysaccharides of algae: 55. Polysaccharide composition of several brown algae from Kamchatka. Russ J Bioorg Chem 27, 395399.CrossRefGoogle ScholarPubMed
27. O'Shea, CJ, Sweeney, T, Bahar, B, et al. (2012) Indices of gastrointestinal fermentation and manure emissions of growing–finishing pigs as influenced through singular or combined consumption of Lactobacillus plantarum and inulin. J Anim Sci 90, 38483857.CrossRefGoogle ScholarPubMed
28. Metzler-Zebeli, BU, Hooda, S, Pieper, R, et al. (2010) Nonstarch polysaccharides modulate bacterial microbiota, pathways for butyrate production, and abundance of pathogenic Escherichia coli in the pig gastrointestinal tract. Appl Environ Microbiol 76, 36923701.CrossRefGoogle ScholarPubMed
29. Lee, C, Kim, J, Shin, SG, et al. (2006) Absolute and relative qPCR quantification of plasmid copy number in Escherichia coli . J Biotechnol 123, 273280.CrossRefGoogle ScholarPubMed
30. Liu, P, Piao, XS, Thacker, PA, et al. (2010) Chito-oligosaccharide reduces diarrhea incidence and attenuates the immune response of weaned pigs challenged with Escherichia coli K88. J Anim Sci 88, 38713879.CrossRefGoogle ScholarPubMed
31. Smith, AG, O'Doherty, JV, Reilly, P, et al. (2011) The effects of laminarin derived from Laminaria digitata on measurements of gut health: selected bacterial populations, intestinal fermentation, mucin gene expression and cytokine gene expression in the pig. Br J Nutr 105, 669677.CrossRefGoogle ScholarPubMed
32. Ryan, MT, Collins, CB, O'Doherty, JV, et al. (2010) Selection of stable reference genes for quantitative real-time PCR in porcine gastrointestinal tissues. Livest Sci 133, 4244.CrossRefGoogle Scholar
33. Vandesompele, J, De Preter, K, Pattyn, F, et al. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, research0034.1–research0034.11.CrossRefGoogle ScholarPubMed
34. Statistical Analysis Systems Institute (1985) Statistical Analysis Systems, 6.12 ed. Cary, NC: SAS Institute, Inc.Google ScholarPubMed
35. Meredith, MJ (1995) Pigs breeding and infertility. In Animal Breeding and Infertility, pp. 278353 [Meredith, MJ, editor]. Oxford: Blackwell Science.Google Scholar
36. Hakkarainen, J (1975) Developmental changes of protein, RNA, DNA, lipid, and glycogen in the liver, skeletal muscle and brain of the pig. Acta Vet Scand 59, Suppl., 1198.Google Scholar
37. Lahaye, M & Keaffer, B (1997) Seaweed dietary fibres: structure, physico-chemical and biological properties relevant to intestinal physiology. Sci Aliments 17, 563584.Google Scholar
38. MacArtain, P, Gill, CIR, Brooks, M, et al. (2007) Nutritional value of edible seaweeds. Nutr Rev 65, 535543.CrossRefGoogle ScholarPubMed
39. Bourne, FJ & Curtis, J (1973) The transfer of immunoglobins IgG, IgA and IgM from serum to colostrum and milk in the sow. Immunology 24, 157162.Google ScholarPubMed
40. Huang, SC, Hu, Z, Hasler-Rapacz, J, et al. (1992) Preferential mammary storage and secretion of immunoglobulin γ (IgG) subclasses in swine. J Reprod Immunol 21, 1528.CrossRefGoogle ScholarPubMed
41. Schnulle, PM & Hurley, WL (2003) Sequence and expression of the FcRn in the porcine mammary gland. Vet Immunol Immunopathol 91, 227231.CrossRefGoogle ScholarPubMed
42. Lallès, JP, Bosi, P, Smidt, H, et al. (2007) Weaning – a challenge to gut physiologists. Livest Sci 108, 8293.CrossRefGoogle Scholar
43. Daniel, H (2004) Molecular and integrative physiology of intestinal peptide transport. Annu Rev Physiol 66, 361384.CrossRefGoogle ScholarPubMed
44. Van Goudoever, JB, Corpeleijn, W, Riedijk, M, et al. (2008) The impact of enteral insulin-like growth factor 1 and nutrition on gut permeability and amino acid utilization. J Nutr 138, 1829S1833S.Google ScholarPubMed
45. Cera, KR, Mahan, DC, Cross, RF, et al. (1988) Effect of age, weaning and postweaning diet on small intestinal growth and jejunal morphology in young swine. J Anim Sci 66, 574584.CrossRefGoogle ScholarPubMed
46. Pluske, JR, Hampson, DJ & Williams, IH (1997) Factors influencing the structure and function of the small intestine in the weaned pig: a review. Livest Prod Sci 51, 215236.CrossRefGoogle Scholar
47. Ferraris, RP (2001) Dietary and developmental regulation of intestinal sugar transport. Biochem J 360, 265276.CrossRefGoogle ScholarPubMed
48. Toloza, EM & Diamond, J (1992) Ontogenetic development of nutrient transporters in rat intestine. Am J Physiol 263, G593G604.Google ScholarPubMed
49. Shu, HJ, Takeda, H, Shinzawa, H, et al. (2002) Effect of lipopolysaccharide on peptide transporter 1 expression in rat small intestine and its attenuation by dexamethasone. Digestion 65, 2129.CrossRefGoogle ScholarPubMed
50. Heim, G, O'Shea, CJ, Doyle, DN, et al. (2015) Effect of maternal dietary supplementation of laminarin and fucoidan, independently or in combination, on pig growth performance and aspects of intestinal health. Anim Feed Sci Tech 204, 2841.CrossRefGoogle Scholar
51. Sweeney, T, Collins, C, Reilly, P, et al. (2012). Effect of purified β-glucans derived from Laminaria digitata, Laminaria hyperborea and Saccharomyces cerevisiae on piglet performance, selected bacterial populations, volatile fatty acids and pro-inflammatory cytokines in the gastrointestinal tract of pigs. Br J Nutr 108, 12261234.CrossRefGoogle ScholarPubMed
52. Shibata, H, Iimuro, M, Uchiya, N, et al. (2003) Preventive effects of Cladosiphon fucoidan against Helicobacter pylori infection in Mongolian gerbils. Helicobacter 8, 5965.CrossRefGoogle ScholarPubMed
53. Nyachoti, CM, Omogbenigun, FO, Rademacher, M, et al. (2006). Performance responses and indicators of gastrointestinal health in early-weaned pigs fed low-protein amino acid-supplemented diets. J Anim Sci 84, 125134.CrossRefGoogle ScholarPubMed
54. Medvedev, AE, Piao, W, Shoenfelt, J, et al. (2007) Role of TLR4 tyrosine phosphorylation in signal transduction and endotoxin tolerance. J Biol Chem 282, 1604216053.CrossRefGoogle ScholarPubMed
55. Johnson, RW & von Borell, E (1994) Lipopolysaccharide-induced sickness behavior in pigs is inhibited by pretreatment with indomethacin. J Anim Sci 72, 309314.CrossRefGoogle ScholarPubMed
56. Johnson, RW (1997) Inhibition of growth by pro-inflammatory cytokines: an integrated view. J Anim Sci 75, 12441255.CrossRefGoogle ScholarPubMed
57. Mair, KH, Sedlak, C, Käser, T, et al. (2014) The porcine innate immune system: an update. Dev Comp Biol 45, 321343.Google ScholarPubMed
58. Dalrymple, SA, Slattery, R, Aud, DM, et al. (1996) Interleukin-6 is required for a protective immune response to systemic Escherichia coli infection. Infec Immun 64, 32313235.Google ScholarPubMed
59. Kasahara, T, Mukaida, N, Yamashita, K, et al. (1991) IL-1 and TNF-α induction of IL-8 and monocyte chemotactic and activating factor (MCAF) mRNA expression in a human astrocytoma cell line. Immunology 74, 6067.Google Scholar
60. McLamb, BL, Gibson, AJ, Overman, EL, et al. (2013) Early weaning stress in pigs impairs innate mucosal immune responses to enterotoxigenic E. coli challenge and exacerbates intestinal injury and clinical disease. PLOS ONE 8, e59838.CrossRefGoogle ScholarPubMed
61. Li, J, Li, DF, Xing, JJ, et al. (2006) Effects of β-glucans extracted from Saccharomyces cerevisiae on growth performance, and immunological and somatotropic responses of pigs challenged with Escherichia coli lipopolysaccharide. J Anim Sci 84, 23742381.CrossRefGoogle ScholarPubMed
62. Lauw, FN, Pajkrt, D, Hack, CE, et al. (2000) Proinflammatory effects of IL-10 during human endotoxemia. J Immunol 165, 27832789.CrossRefGoogle ScholarPubMed
63. Girard, F, Oswald, IP, Taranu, I, et al. (2005) Host immune status influences the development of attaching and effacing lesions in weaned pigs. Infect Immun 73, 55145523.CrossRefGoogle ScholarPubMed
64. Brown, GD & Gordon, S (2005) Immune recognition of fungal β-glucans. Cell Microbiol 7, 471479.CrossRefGoogle ScholarPubMed
65. Xiao, Z, Trincado, CA & Murtaugh, MPB (2004) Glucan enhancement of T cell IFN-γ response in swine. Vet Immunol Immunopathol 102, 315320.CrossRefGoogle Scholar
66. Chaung, HC, Huang, TC, Yu, JH, et al. (2009) Immunomodulatory effects of β-glucans on porcine aveolar macrophages and bone marrow haematopoietic cell-derived dendritic cells. Vet Immunol Immunopathol 131, 147157.CrossRefGoogle Scholar
67. Sauvant, D, Perez, J-M & Tran, G (editors) (2004) Tables of Composition and Nutritional Value of Feed Materials. Pigs, Poultry, Cattle, Sheep, Goats, Rabbits, Horses, Fish. Wageningen: Wageningen Academic Publishers.Google Scholar
You have Access
Open access

Send article to Kindle

To send this article to your Kindle, first ensure is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about sending to your Kindle. Find out more about sending to your Kindle.

Note you can select to send to either the or variations. ‘’ emails are free but can only be sent to your device when it is connected to wi-fi. ‘’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service.

Maternal supplementation of seaweed-derived polysaccharides improves intestinal health and immune status of suckling piglets
Available formats

Send article to Dropbox

To send this article to your Dropbox account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Dropbox.

Maternal supplementation of seaweed-derived polysaccharides improves intestinal health and immune status of suckling piglets
Available formats

Send article to Google Drive

To send this article to your Google Drive account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Google Drive.

Maternal supplementation of seaweed-derived polysaccharides improves intestinal health and immune status of suckling piglets
Available formats

Reply to: Submit a response

Your details

Conflicting interests

Do you have any conflicting interests? *