Skip to main content Accessibility help
×
Home
Hostname: page-component-59b7f5684b-9m8n8 Total loading time: 0.967 Render date: 2022-09-29T22:04:16.739Z Has data issue: true Feature Flags: { "shouldUseShareProductTool": true, "shouldUseHypothesis": true, "isUnsiloEnabled": true, "useRatesEcommerce": false, "displayNetworkTab": true, "displayNetworkMapGraph": false, "useSa": true } hasContentIssue true

Determination of lumefantrine as an effective drug against Toxoplasma gondii infection – in vitro and in vivo study

Published online by Cambridge University Press:  22 October 2020

Dawei Wang
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China College of Food Science, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Mengen Xing
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Saeed El-Ashram
Affiliation:
College of Life Science and Engineering, Foshan University, 18 Jiangwan Street, Foshan, 528231, Guangdong Province, China Faculty of Science, Kafrelsheikh University, Kafr El-Sheikh, 33516, Egypt
Yingying Ding
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Xiao Zhang
Affiliation:
Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Taian City, Shandong Province, China
Xiaoyu Sang
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Ying Feng
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Ran Chen
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Xinyi Wang
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Ning Jiang
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Qijun Chen
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
Na Yang*
Affiliation:
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866Shengyang, China
*
Author for correspondence: Na Yang, E-mail: dayangna@syau.edu.cn

Abstract

Toxoplasma gondii is an obligate intracellular protozoan parasite, which can infect almost all warm-blooded animals, including humans, leading to toxoplasmosis. Currently, the effective treatment for human toxoplasmosis is the combination of sulphadiazine and pyrimethamine. However, both drugs have serious side-effects and toxicity in the host. Therefore, there is an urgent need for the discovery of new anti-T. gondii drugs with high potency and less or no side-effects. Our findings suggest that lumefantrine exerts activity against T. gondii by inhibiting its proliferation in Vero cells in vitro without being toxic to Vero cells (P ≤ 0.01). Lumefantrine prolonged mice infected with T. gondii from death for 3 days at the concentration of 50 μg L−1 than negative control (phosphate-buffered saline treated only), and reduced the parasite burden in mouse tissues in vivo (P ≤ 0.01; P ≤ 0.05). In addition, a significant increase in interferon gamma (IFN-γ) production was observed in high-dose lumefantrine-treated mice (P ≤ 0.01), whereas interleukin 10 (IL-10) and IL-4 levels increased in low-dose lumefantrine-treated mice (P ≤ 0.01). The results demonstrated that lumefantrine may be a promising agent to treat toxoplasmosis, and more experiments on the protective mechanism of lumefantrine should be undertaken in further studies.

Type
Research Article
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted re-use, distribution, and reproduction in any medium, provided the original work is properly cited.
Copyright
Copyright © The Author(s), 2020. Published by Cambridge University Press

Introduction

Toxoplasma gondii is an obligate intracellular protozoan parasite, which can infect almost all warm-blooded, including humans, leading to toxoplasmosis (Dubey, Reference Dubey2010; El-Ashram et al., Reference El-Ashram, Sun, Yin, Liu and Suo2015a, Reference El-Ashram, Yin, Barta, Khan, Liu and Suo2015b; Yin et al., Reference Yin, El-Ashram, Liu, Sun, Zhao, Liu and Suo2015a, Reference Yin, El-Ashram, Liu and Suo2015b). Approximately 30% of the world's population has serological evidence of T. gondii infection (Zhou et al., Reference Zhou, Chen, Li, Zheng, He, Lin and Zhu2011). Toxoplasmosis is normally innocuous in individuals with a good immune system; however, T. gondii infection is severe or even fatal for immunocompromised patients, such as those with AIDS, tumour and organ transplant recipients (Tian et al., Reference Tian, Dai, Huang, Deng, Duan, Zhou, Yang, Weng, Zhu and Zou2012; Qin et al., Reference Qin, Cong, Liu, Li, Wang, Zhang, Huang, Zhu and Liu2014; Wang et al., Reference Wang, Liu, Jiang, Zhang, Yuan, He, Su and Yang2016).

Several anti-T. gondii drugs, including sulphonamides and pyrimethamine have been used to control toxoplasmosis (Montoya and Liesenfeld, Reference Montoya and Liesenfeld2004; Meneceur et al., Reference Meneceur, Bouldouyre, Aubert, Villena, Menotti, Sauvage, Garin and Derouin2008; Doliwa et al., Reference Doliwa, Escotte-Binet, Aubert, Velard, Schmid, Geers and Villena2013a, Reference Doliwa, Xia, Escotte-Binet, Newsham, Sanya, Aubert, Randle, Wastling and Villena2013b). Both sulphonamides and pyrimethamine prevent the synthesis of folate by inhibiting the dihydrofolate reductase and dihydropteroate synthase that are essential for the survival and multiplication of parasites (Derouin, Reference Derouin2001; Anderson, Reference Anderson2005). However, these drugs cannot completely inactivate encysted bradyzoites or treat congenital toxoplasmosis, and their use is also limited by their side-effects, including haematological toxicity (pyrimethamine), cutaneous rash, leucopoenia and thrombocytopoenia (sulphonamides) (Agha et al., Reference Agha, Sadaruddin and Ghafoor1992; Subauste and Remington, Reference Subauste and Remington1993; Kim et al., Reference Kim, Sharon, Chu, Rais, Al-Safarjalani, Naguib and El-Kouni2007; Torre et al., Reference Torre, Stanford, Curi, Jaffe and Gomez-Marin2011). There is increasing evidence of treatment failures in patients affected by toxoplasmosis suggesting the existence of drug resistance in clinical therapy against sulphonamides and pyrimethamine (Doliwa et al., Reference Doliwa, Escotte-Binet, Aubert, Velard, Schmid, Geers and Villena2013a, Reference Doliwa, Xia, Escotte-Binet, Newsham, Sanya, Aubert, Randle, Wastling and Villena2013b). Continuous efforts have been made to develop drugs for the treatment of toxoplasmosis. However, drug development is an expensive and lengthy process (Hoelder et al., Reference Hoelder, Clarke and Workman2012). In an attempt to accelerate the process of drug discovery, older drugs are being tested and developed for new activities.

Lumefantrine, previously named benflumetol (a fluorene derivative belonging to the aminoalcohol class), is an antimalarial drug synthesized in the 1970s in China, which action mechanism is unclear (Olliaro and Trigg, Reference Olliaro and Trigg1995). Lumefantrine, which exhibits potent antimalarial activities, with a half-life of 3–5 days in malaria patients (Ezzet et al., Reference Ezzet, Mull and Karbwang1998), can eliminate the Plasmodium parasites that remain in the blood following exposure to a fast-acting agent, such as artemisinin, thereby preventing recrudescence (Richard et al., Reference Richard, Pauline, Mohammed, Concepta, Michael, Warunee, Nicholas, Nicholas, Angela and Joel2014). Lumefantrine was widely used to treat different types of Plasmodium, which was assessed the interaction against 13 Plasmodium falciparum strains by isotopic test in vitro (Dormoi et al., Reference Dormoi, Savini, Amalvict, Baret and Pradines2014). A report about lumefantrine against 61 fresh clinical isolates of P. falciparum in Cameroon showed that lumefantrine possessed high activity in vitro compared with mefloquine, which were in agreement with the promising results of preliminary clinical trials (Basco et al., Reference Basco, Bickii and Ringwald1998). Lumefantrine also showed a good therapeutic effect on treating Plasmodium berghei, a developed lipidic system of lumefantrine exhibited excellent anti-P. berghei activity with 100% survival in male Swiss mice (Patil et al., Reference Patil, Suryavanshi, Pathak, Sharma and Patravale2013). In addition, lumefantrine is used to treat apicomplexans such as Theileria equi and Babesia caballi recently (Maji et al., Reference Maji, Goel, Suthar, Mandal, Gopalakrishnan, Kumar, Tripathi and Kumar2019). As the first-line treatment of uncomplicated malaria caused by P. falciparum (WHO, 2010), lumefantrine was always combined with other agents, such as artemisinin, cepharanthine and atorvastatin (Desgrouas et al., Reference Desgrouas, Dormoi, Chapus, Ollivier, Parzy and Taudon2014; Dormoi et al., Reference Dormoi, Savini, Amalvict, Baret and Pradines2014). In Guyana, the combination of lumefantrine and artemisinin has shown a better treatment effect for Plasmodium vivax than using lumefantrine or artemisinin alone. Chemotherapy drugs with well-matched pharmacokinetics are usually combined to improve treatment effect, and a combination of anti-malarial drugs usually associates a drug with a short elimination half-life and a drug with a long elimination half-life (Dormoi et al., Reference Dormoi, Savini, Amalvict, Baret and Pradines2014). Artemisinin is a kind of rapidly cidal antimalarial but with a high recurrence rate, whereas lumefantrine eliminates parasites more thoroughly and lasts for long time but the effect is slow (White et al., Reference White, Vugt and Ezzet1999), so the combination of these two drugs is often used in clinical malaria treatments (Eibach et al., Reference Eibach, Ceron, Krishnalall, Carter, Bonnot, Bienvenu and Picot2012; Dormoi et al., Reference Dormoi, Savini, Amalvict, Baret and Pradines2014). Both T. gondii and P. falciparum are apicomplexan protozoa, however, the effect of lumefantrine on T. gondii has never been studied. There is an urgent need for the discovery of new anti-T. gondii drugs with high potency and less or no side-effects. Therefore, the aim of this study was to evaluate the activity of lumefantrine against T. gondii using cell culture and mice infected with T. gondii (RH strain) as in vitro and in vivo experimental models, respectively.

Materials and methods

Ethical standards

Experiments were performed using female Kunming (KM) mice (6–8 weeks old) obtained from Liaoning Changsheng Biotechnology Company, China. All animals were handled in strict accordance with good animal practice according to the Animal Ethics Procedures and Guidelines of the People's Republic of China, and the study was approved by the Animal Ethics Committee of Shenyang Agricultural University (Permit no. SYXK2011-0001), and all efforts were made to minimize suffering.

Cells and parasites

Cells were cultured in 25 cm2 culture flasks in DMEM medium (Macgene, China) supplemented with 100 U mL−1 penicillin, 100 μg mL−1 streptomycin (Macgene, China) and 10% heat-inactivated foetal bovine serum (FBS) (BI, Israel) at 37°C under a 5% CO2 atmosphere. Toxoplasma gondii tachyzoites (RH strain) were maintained in Vero cells cultured in DMEM medium supplemented with penicillin, streptomycin and 2% FBS at 37°C and 5% CO2.

Cytotoxicity assay

Cytotoxicity of sulphadiazine and lumefantrine (Sigma, USA) to Vero cells was evaluated by the methyl thiazolyl tetrazolium (MTT) assay (Chen et al., Reference Chen, Wu, Jiang, Feng and Cao2008; Kavitha et al., Reference Kavitha, Noordin, Chan and Sasidharan2010). Vero cells (2 × 105) were seeded in 96-well plates and cultured in 10% FBS-DMEM for 12 h to obtain a monolayer. Vero cell monolayers were washed and directly subjected to lumefantrine (dilution from 50 to 1.563 μg L−1) or sulphadiazine (dilution from 500 to 15.625 mg L−1, from 100 to 3.125 mg L−1 and from 30 to 0.9375 mg L−1, respectively), which were diluted with 10% FBS-DMEM. The Vero cells were subsequently cultured for 24 and 48 h. As a control, Vero cells were treated with 200 μL 10% FBS-DMEM (blank control/DMEM group) and 20 μL dimethyl sulphoxide (DMSO) (1 μL mL−1) (Sigma, USA) together with 180 μL 10% FBS-DMEM (solvent control/DMSO group). Supernatants were removed after culturing for 24 or 48 h, and the plates were washed twice by using phosphate-buffered saline (PBS) and pulsed by adding 10 μL of MTT (Solarbio, China) together with 90 μL 10% FBS-DMEM for 4 h under the same culture conditions. The supernatants were removed gently with pipettes and 110 μL formazan was added to each well. The plates were vibrated on a low-speed oscillator, and optical density (OD) was measured at 490 nm by using a microplate reader after 30 min (Tecan, Switzerland).

Proliferation assay in vitro

The anti-proliferation effect of lumefantrine on T. gondii was also detected using the MTT assay. Vero cell monolayers in 96-well plates were infected with 1 × 106 fresh RH tachyzoites per well and incubated for 2 h at 37°C. Then, the Vero cell monolayers were washed twice with PBS to remove extracellular tachyzoites and incubated with DMEM (2% FBS) containing different concentrations of lumefantrine (50, 9.375 or 1.563 μg L−1) for 24 and 48 h. The sulphadiazine (10 mg L−1) was added as a positive control. Toxoplasma gondii-infected Vero cells with DMEM only were used as a negative control. The MTT assay was carried out to evaluate parasite proliferation as previously described.

In addition, to further verify parasite proliferation, flow cytometry was conducted. Vero cell monolayers in six-well plates were infected with 1 × 106 fresh RH tachyzoites per well and incubated for 2 h at 37°C. Then, the Vero cell monolayers were washed twice with PBS to remove extracellular tachyzoites and incubated with DMEM (2% FBS) containing different concentrations of lumefantrine and sulphadiazine for 24 h, respectively. Vero cells without RH tachyzoites were used as blank control and Vero cells seeded RH tachyzoites with DMEM only were used as negative control. After that, all the groups were digested by trypsin without EDTA at 37°C for 5 min, respectively, washed twice with PBS, stained with annexin V-labelled fluorescein 5-isothiocyanate (annexin V-FITC) (Biolegend, USA) and propidium iodide (Biolegend, USA), and incubated at room temperature for 10–15 min without light. Parasite proliferation was measured using a flow cytometer (BD, USA) (Hou et al., Reference Hou, Piao, Liu, Wu and Chen2015).

Effect of lumefantrine on mice infected by T. gondii

Seventy-two female mice (6–8 weeks) were divided into six treatment groups (12 mice per group). All the mice except for the blank control group (without T. gondii infection) were infected with fresh T. gondii (100 RH tachyzoites per mouse). After 24 h post-infection, the mice were given intragastric administration of sulphadiazine (10 mg L−1; dissolved in PBS) or lumefantrine (50, 9.375 or 1.563 μg L−1; dissolved in PBS) every 2 days. Meanwhile, mice in both blank and negative groups (T. gondii infected-mice treated with PBS only) were injected intragastrically with the equal amounts of PBS. Mice were observed daily to record the death time and rate. All mice were humanely killed to collect blood at 11 days post-infection. Liver, heart, spleen and lung tissues were collected and stored in liquid nitrogen for RNA extraction.

Toxoplasma gondii molecular detection in tissues

Tissue RNAs in different groups were extracted using Trizol (Invitrogen, USA), and the extracted RNAs were treated with DNase I (TaKaRa, China) to remove the genomic DNA. The mRNA was reverse transcribed from Oligo (dT) and used as templates for quantitative reverse transcription-polymerase chain reaction (RT-PCR). Specific primers (forward: TCCGGCTTGGCTGCTTT, reverse: TTCAATTCTCTCCGCCATCAC) were designed according to the gene sequence of T. gondii repeat region (AF146527.1), in which fragment was used to develop sensitive and specific PCR for diagnostic purposes (Homan et al., Reference Homan, Vercammen, Braekeleer and Verschueren2000; Pratama et al., Reference Pratama, Biotech and Artama2015). Quantitative RT-PCR was performed on an ABI PRISM 7500 Real-Time PCR System (Applied Biosystems) and each reaction contained 10 μL of 2 × TB Green Premix E × Taq (TaKaRa, China), 1 μL of template cDNA, 6.6 μL of distilled water, 0.4 μL 50 × ROX Reference Dye II and 1 μL each primer. The following amplification conditions were applied: 3 min at 95°C; 40 cycles of 95°C for 15 s (denaturation), 60°C for 40 s (annealing) and a dissociation step was added to confirm the amplification specificity for each gene. Experiment was repeated three times, and transcription levels were represented by the mean values of the three parallel experiments.

Detection of interleukin (IL)-4, IL-10 and interferon gamma (IFN-γ)

The changes of IL-4, IL-10 and IFN-γ in mice treated with lumefantrine or sulphadiazine were evaluated using the cytokine ELISA (enzyme-linked immunosorbent assay) kits (Beyotime, China) according to the manufacturer's instructions. Sera of different treatment groups were collected at 11 days post-infection to detect the changes of cytokine levels through three independent experiments. Absorbance at 450 nm was measured by using a microplate reader (Tecan, Switzerland).

Statistical analysis

Data were analysed using SPSS (ver18.0) computer software (SPSS for Windows, SPSS Inc., 2009). All values are expressed as mean ± s.d. Statistical analysis was performed using analysis of variance. P values less than 0.05 were considered statistically significant.

Results

Cytotoxicity activity

The MTT assay revealed that different concentrations of both lumefantrine and sulphadiazine had no cytotoxicity compared with the blank control (Supplementary Figs S1a and b). After calculation, the CC50 (50% cytotoxicity concentration) of lumefantrine was 4.75 × 108 μg L−1 at 24 h and 1.75 × 105 μg L−1 at 48 h. Thus, different concentrations of lumefantrine (high 50 μg L−1, medium 9.375 μg L−1 and low 1.563 μg L−1) and sulphadiazine (10 mg L−1) were used to carry out further experiments against T. gondii in vitro.

Anti-proliferation activity

Further evaluation of the ability of lumefantrine and sulphadiazine to inhibit the intracellular tachyzoite proliferation within Vero cells was examined using the MTT assay at 24 and 48 h post-treatment (Fig. 1). The absorbance could represent the number of living Vero cells, as parasites will damage living Vero cells when proliferation and invasion, therefore, the absorbance can reflect the inhibition effect of drugs against parasites indirectly. The IC50 (50% antiparasitic concentration) of lumefantrine against T. gondii proliferation was 139 μg L−1 at 24 h and 51.48 μg L−1 at 48 h. This was an indication that lumefantrine could significantly inhibit tachyzoite proliferation compared with the DMEM group (P ≤ 0.01).

Fig. 1. Effects of lumefantrine and sulphadiazine on Toxoplasma gondii proliferation. After 2 h pre-treatment of tachyzoites, Vero cells were separately treated with lumefantrine or sulphadiazine for other 24 and 48 h, respectively. Tachyzoites treated with DMEM only were defined as the negative control and those treated with sulphadiazine (10 mg L−1) as the positive control. The inhibition rates of T. gondii proliferation were calculated by the formula: (Group treatments OD − Group DMEM OD)/Group DMEM OD. Data represent mean ± s.d. of three independent experiments performed in triplicate. Significantly different from the negative control (compared with DMEM group, **P ≤ 0.01, *P ≤ 0.05).

The anti-proliferation activity of lumefantrine was further examined using flow cytometry. Samples were stained with annexin V-FITC and propidium iodide after treatment with lumefantrine or sulphadiazine for 24 h. Different quadrants represent different states of the Vero cells (Q1: necrotic and damaged Vero cells; Q2: late apoptotic Vero cells; Q3: living Vero cells; Q4: early apoptotic Vero cells). After T. gondii invasion and proliferation, they will bring some damage to Vero cells, so the purpose of flow cytometry was used to detect the number of living Vero cells in Q3 quadrant, which can reflect the drug anti-parasite effect indirectly. The more living Vero cells in Q3 quadrant reflect the better effect of lumefantrine on anti-parasite (Fig. 2a). These results showed that different concentrations of lumefantrine could inhibit the proliferation of T. gondii (P ≤ 0.01) by flow cytometry (Figs 2a and b).

Fig. 2. Lumefantrine inhibition of proliferation of T. gondii at 24 h post-treatment by flow cytometry. Tachyzoites were treated with lumefantrine for 24 h. Vero cells treated with DMEM only were defined as the blank control, and tachyzoites treated with DMEM only were defined as the negative control. As a positive control, tachyzoites were treated with sulphadiazine. Samples were stained with annexin V-FITC and propidium iodide, and the percentage of Vero cells in each group was determined by FCM. (a) Results of lumefantrine inhibit proliferation of T. gondii by FCM; (b) histogram based on the number of living Vero cells in the Q3 quadrant by FCM. Data represent mean ± s.d. of three independent experiments performed in triplicate. Significantly different from the negative control (compared with negative group, **P ≤ 0.01, *P ≤ 0.05).

Survival rate of acutely infected mice treated with lumefantrine

Mice were observed daily, and the survival rate was recorded for 11 days post-infection. Toxoplasma gondii infected-mice treated with PBS died at 6 days post-treatment. However, mice treated with 50, 9.375 or 1.563 μg L−1 lumefantrine died at day 9, 8 and 7 post-treatment, respectively. The positive group (sulphadiazine group) died at day 7 post-treatment. After 11 days, 75, 66.7 and 58.3% of mice treated with 50, 9.375 and 1.563 μg L−1 lumefantrine, respectively had survived, whereas only 41.7% living mice treated with 10 mg L−1 sulphadiazine had survived (Fig. 3).

Fig. 3. Effect of lumefantrine on the survival rate of acutely infected mice. All the mice were infected with 100 T. gondii tachyzoites and then treated with lumefantrine (50, 9.375 or 1.563 μg L−1), a positive control (10 mg L−1 sulphadiazine) and PBS (negative control) every 2 days for 10 days. The uninfected control mice were served as blank group, and T. gondii infected-mice treated with PBS only were as the negative group. Mice were observed daily, and the survival rate was recorded for 11 days post-infection.

Parasite load in mice tissues

To evaluate the parasite load in the mice after lumefantrine treatment, liver, heart, spleen and lung samples from infected mice were examined by qPCR, and the results are shown in Fig. 4. Treatment with different concentrations of lumefantrine significantly reduced the parasite load in the liver, heart, spleen and lung tissues compared to the negative control (PBS treated only) (P ≤ 0.01; P ≤ 0.05). The parasite load in different tissues except the liver was also reduced in the positive control group (sulphadiazine group).

Fig. 4. Parasite burden in tissues from the acutely infected mice. Mice were challenged intraperitoneally with 100 T. gondii tachyzoites, treated with lumefantrine (50, 9.375 or 1.563 μg L−1), a positive drug (10 mg L−1 sulphadiazine) and PBS (negative control) every 2 days for 10 days. The uninfected control mice were served as blank group, and T. gondii infected-mice treated with PBS only were as the negative group. The parasite loads in the liver, heart, spleen and lung tissues of the infected mice were isolated and homogenized. Total RNA was isolated, and the T. gondii repeat region was detected by qPCR. The quantified parasite loads in the tissues of mice are presented as the fold change of −log10 values of the numbers of tachyzoites per 20 mg of tissues. Data represent mean ± s.d. of three independent experiments performed in triplicate. Significantly different from the negative control (compared with negative group, **P ≤ 0.01, *P ≤ 0.05).

Regulation of cytokine levels by lumefantrine in mice infected by T. gondii

In order to determine whether lumefantrine treatment enhances Th1 or Th2 cytokine response, IFN-γ, IL-4 and IL-10 levels in the serum of mice were determined (Fig. 5). Significantly higher levels of IFN-γ were observed in mice treated with a high concentration lumefantrine compared to the negative control group (P ≤ 0.01), which indicated that high concentration lumefantrine could stimulate the hosts to produce IFN-γ to eliminate T. gondii. Meanwhile, IL-4 and IL-10 were significantly produced in mice treated with a low concentration lumefantrine compared to the negative control group (P ≤ 0.01). The results showed that lumefantrine could adjust the cytokines in hosts to eliminate parasites through the change of drug concentrations.

Fig. 5. Lumefantrine regulates the change of cytokines. Mice were challenged intraperitoneally with 100 T. gondii tachyzoites and treated with lumefantrine (50, 9.375 or 1.563 μg L−1), a positive drug (10 mg L−1 sulphadiazine) and PBS (negative control) every 2 days for 10 days. The uninfected control mice were served as blank group, and T. gondii infected-mice treated with PBS only were as the negative group. Sera of infected mice were collected at 11 days post-infection, and the cytokine levels were detected using a microplate reader. Cytokine levels were expressed as ng L−1 or pg mL−1. Three independent experiments were performed, and data are presented as mean ± s.d. Significantly different from the negative control (compared with negative group, **P ≤ 0.01, *P ≤ 0.05).

Discussion

Lumefantrine has been shown to have a prominent inhibition effect on P. vivax (sexual and asexual stages), P. falciparum, P. berghei, T. equi and B. caballi (Eibach et al., Reference Eibach, Ceron, Krishnalall, Carter, Bonnot, Bienvenu and Picot2012; Patil et al., Reference Patil, Suryavanshi, Pathak, Sharma and Patravale2013; Gimode et al., Reference Gimode, Kiboi, Kimani, Wamakima, Burugu and Muregi2015; WorldWide Antimalarial Resistance Network (WWARN) Lumefantrine PK/PD Study Group, 2015; Maji et al., Reference Maji, Goel, Suthar, Mandal, Gopalakrishnan, Kumar, Tripathi and Kumar2019). The terminal elimination half-life of a drug is an important determinant of the propensity for an anti-malarial drug to select for resistance. Therefore, the mismatch between the short-acting artemisinin derivative and the long-acting partner drug provides selection pressure for emergence of resistant parasites, since one drug is rapidly eliminated and the other drug persists alone (Gimode et al., Reference Gimode, Kiboi, Kimani, Wamakima, Burugu and Muregi2015). Lumefantrine is a longer-acting drug, and confers protection against recrudescence following malaria infection (Kokwaro et al., Reference Kokwaro, Mwai and Nzila2007). At present, artemether/lumefantrine (AL) is the only fixed-dose artemisinin-based combination therapy recommended and pre-qualified by the World Health Organization (WHO) for the treatment of uncomplicated malaria caused by P. falciparum. It has been shown to be effective both in sub-Saharan Africa and in areas with multi-drug resistant P. falciparum in southeast Asia (Kokwaro et al., Reference Kokwaro, Mwai and Nzila2007). It is currently recommended as first-line treatment for uncomplicated malaria in several countries. Toxoplasma gondii is an apicomplexan protozoa, which is like Plasmodium. Thus, we can infer that lumefantrine may act against apicomplexan parasites. It is necessary to explore whether lumefantrine has anti-T. gondii activity in vitro and in vivo. Besides, studies that have shown successful treatment for toxoplasmosis patients are limited, indicating the urgent need to identify and develop new therapies (Adeyemi et al., Reference Adeyemi, Sugi, Han and Kato2018) and data about the inhibition of T. gondii using lumefantrine is not available. Therefore, in this study, we evaluated the effect of lumefantrine treatment on T. gondii infection in vivo and in vitro.

The results showed that lumefantrine demonstrated activity against T. gondii RH strain tachyzoites. Lumefantrine affects the intracellular of T. gondii tachyzoites in a concentration-dependent manner compared with the negative control (DMEM group) (P ≤ 0.01), as determined through in vitro anti-proliferation assays. Furthermore, lumefantrine showed low cytotoxicity in Vero cells and the findings are consistent with the previous report (Kokwaro et al., Reference Kokwaro, Mwai and Nzila2007), and the CC50 of lumefantrine for Vero cells was 3 417 266-fold higher than the IC50 against T. gondii at 24 h and 3399-fold higher at 48 h, which demonstrates that lumefantrine has a high therapeutic index and the use of lumefantrine has a wide safety range. In addition, compared with other recently described natural products, matrine (ME) (Zhang et al., Reference Zhang, Jin, Cui, Zhang, Wu, Park, Quan and Jin2016), ginkgolic acids (Choi et al., Reference Choi, Gang and Yun2008) and other plant extracts (Sepulveda-Arias et al., Reference Sepulveda-Arias, Veloza and Mantilla-Muriel2014), the IC50 of lumefantrine was lower than those drugs, indicating that at the same concentration, the anti-T. gondii activity of lumefantrine was better than natural products, matrine (ME), and ginkgolic acids. Anti-proliferation assay showed that a 21.12% reduction at 24 h and a 41.2% reduction at 48 h post-treatment with lumefantrine were recorded (P ≤ 0.01), which was also verified by flow cytometry. Accordingly, we can conclude that lumefantrine presents a potent anti-T. gondii activity in vitro.

Based on the in vitro results above, we sought to determine whether lumefantrine exerts anti-T. gondii effects on acute infections in vivo. Thus, a mouse model was established by infecting mice with the virulent RH strain of T. gondii. Before that, we treated healthy mice with the same doses of lumefantrine, and all the mice survived. Evaluation of anti-T. gondii effects of lumefantrine on mice acutely infected by the RH strain of T. gondii revealed 75, 66.7 and 58.3% of mice treated with 50, 9.375 and 1.563 μg L−1 lumefantrine, respectively had survived at 11 days post-treatment, and only 41.7% living mice treated with 10 mg L−1 sulphadiazine had survived. Furthermore, the parasite burdens in the liver, heart, spleen and lung after lumefantrine treatment were significantly decreased compared with those in the negative control group (PBS-treated only) (P ≤ 0.01; P ≤ 0.05), indicating that lumefantrine exerts an inhibitory effect on T. gondii, partially provides protection against death due to T. gondii infection, and reduces the parasite burden in the tissues of mice. Lumefantrine has a wide safety range and a small side-effect. High levels of Th1 (IFN-γ) and Th2 (IL-4 and IL-10) cytokines were detected in lumefantrine-treated mice. IFN-γ was the key cytokine in resistance against T. gondii infection (Dautu et al., Reference Dautu, Munyaka, Carmen, Zhang, Omata and Xuenan2007). IFN-γ can inhibit the proliferation of T. gondii in infected host cells through various mechanisms, including induction of the inhibitory protein guanamine 2,3-dioxygenase, inducible nitric oxide synthase, the effector proteins immunity-related GTPases and guanylate-binding proteins (Zheng et al., Reference Zheng, Ding, Lou, Tong, Zhuo, Ding, Kong and Lu2019a). In the current study, a significant increase in IFN-γ production in mice treated with a high-dose lumefantrine improved mouse survival (P ≤ 0.01). These results indicate that lumefantrine can trigger an increased IFN-γ production and contribute to the prevention of acute T. gondii infection. Meanwhile, an increase in IL-10 and IL-4 levels was also observed in mice, which received a low dose of lumefantrine (P ≤ 0.01). IL-10 has a central role in limiting inflammation and inhibiting CD4+ T cell-mediated severe immunopathology (Dupont et al., Reference Dupont, Christian and Hunter2012), and IL-4 functions to enhance IFN-γ production in the late stage of infection (Zheng et al., Reference Zheng, Lou, Ding, Zhuo, Ding, Kong and Lu2019b).

Lumefantrine is a kind of antimalarial drug with a long half-life period, the mechanism of action and resistance mechanism of lumefantrine is still not clear. It belongs to aromatic cyclic methanol, and it's actually in the same class as quinine, which is also an important antimalarial drug (Xi, Reference Xi2006). Quinine can bind to the DNA of the malaria parasite, forming complex and inhibiting DNA replication and RNA transcription, thus inhibit the protozoan protein synthesis (Xi, Reference Xi2006). Based on these results in this study, we speculate that lumefantrine may be used to treat toxoplasmosis patients or people who suffer combination infections of T. gondii and Plasmodium clinically, meanwhile, the combination of artemether and lumefantrine may play a better effect for treating patients with T. gondii infections. Thus, more experiments on the protective and therapeutic mechanisms of lumefantrine should be undertaken to understand the effects of lumefantrine only or artemether/lumefantrine combination on T. gondii tachyzoites and bradyzoites or on different T. gondii types.

Supplementary material

The supplementary material for this article can be found at https://doi.org/10.1017/S0031182020002036

Financial support

This study was supported by grants from the National Natural Science Foundation of China (Grant Number 31672546) and LiaoNing Revitalization Talents Program (XLYC1907091).

Conflict of interest

The authors declare no conflict of interest.

References

Adeyemi, OS, Sugi, T, Han, Y and Kato, K (2018) Screening of chemical compound libraries identified new anti-Toxoplasma gondii agents. Parasitology Research 117, 355363.CrossRefGoogle ScholarPubMed
Agha, F, Sadaruddin, A and Ghafoor, A (1992) Human toxoplasmosis. Journal of the Pakistan Medical Association 42, 224226.Google ScholarPubMed
Anderson, AC (2005) Targeting DHFR in parasitic protozoa. Drug Discovery Today 10, 121128.CrossRefGoogle ScholarPubMed
Basco, LK, Bickii, J and Ringwald, P (1998) In vitro activity of lumefantrine (benflumetol) against clinical isolates of Plasmodium falciparum in Yaoundé, Cameroon. Antimicrobial Agents and Chemotherapy 42, 23472351.CrossRefGoogle ScholarPubMed
Chen, SX, Wu, L, Jiang, XG, Feng, YY and Cao, JP (2008) Anti-Toxoplasma gondii activity of GAS in vitro. Journal of Ethnopharmacology 118, 503507.CrossRefGoogle ScholarPubMed
Choi, KM, Gang, J and Yun, J (2008) Anti-Toxoplasma gondii RH strain activity of herbal extracts used in traditional medicine. International Journal of Antimicrobial Agents 32, 360362.CrossRefGoogle ScholarPubMed
Dautu, G, Munyaka, B, Carmen, G, Zhang, G, Omata, Y and Xuenan, X (2007) Toxoplasma gondii: DNA vaccination with genes encoding antigens MIC2, M2AP, AMA1 and BAG1 and evaluation of their immunogenic potential. Experimental Parasitology 116, 273282.CrossRefGoogle ScholarPubMed
Derouin, F (2001) Anti-toxoplasmosis drugs. Current Opinion in Investigational Drugs 2, 13681374.Google ScholarPubMed
Desgrouas, C, Dormoi, J, Chapus, C, Ollivier, E, Parzy, D and Taudon, N (2014) In vitro and in vivo combination of cepharanthine with anti-malarial drugs. Malaria Journal 13, 90.CrossRefGoogle ScholarPubMed
Doliwa, C, Escotte-Binet, S, Aubert, D, Velard, F, Schmid, F, Geers, R and Villena, I (2013 a) Induction of sulfadiazine resistance in vitro in Toxoplasma gondii. Experimental Parasitology 133, 131136.CrossRefGoogle ScholarPubMed
Doliwa, C, Xia, D, Escotte-Binet, S, Newsham, EL, Sanya, JS, Aubert, D, Randle, N, Wastling, JM and Villena, I (2013 b) Identification of differentially expressed proteins in sulfadiazine resistant and sensitive strains of Toxoplasma gondii using difference-gel electrophoresis (DIGE). International Journal for Parasitology-Drugs and Drug Resistance 3, 3544.CrossRefGoogle Scholar
Dormoi, J, Savini, H, Amalvict, R, Baret, E and Pradines, B (2014) In vitro interaction of lumefantrine and piperaquine by atorvastatin against Plasmodium falciparum. Malaria Journal 13, 189.CrossRefGoogle ScholarPubMed
Dubey, JP (2010) Toxoplasmosis of Animals and Humans, 2nd Edn. Boca Raton: CRC Press.Google Scholar
Dupont, CD, Christian, DA and Hunter, CA (2012) Immune response and immunopathology during toxoplasmosis. Seminars in Immunopathology 34, 793813.CrossRefGoogle ScholarPubMed
Eibach, D, Ceron, N, Krishnalall, K, Carter, K, Bonnot, G, Bienvenu, AL and Picot, S (2012) Therapeutic efficacy of artemether-lumefantrine for Plasmodium vivax infections in a prospective study in Guyana. Malaria Journal 11, 347.CrossRefGoogle Scholar
El-Ashram, S, Sun, X, Yin, Q, Liu, X and Suo, X (2015 a) Exploring early and late Toxoplasma gondii strain RH infection by two-dimensional immunoblots of chicken immunoglobulin G and M profiles. PLoS One 10, e0121647.CrossRefGoogle ScholarPubMed
El-Ashram, S, Yin, Q, Barta, JR, Khan, J, Liu, X and Suo, X (2015 b) Immunoproteomic technology offers an extraordinary diagnostic approach for Toxoplasma gondii infection. Journal of Microbiological Methods 119, 1830.CrossRefGoogle ScholarPubMed
Ezzet, F, Mull, R and Karbwang, J (1998) Population pharmacokinetics and therapeutic response of CGP 56697 (artemether + benflumetol) in malaria patients. British Journal of Clinical Pharmacology 46, 553561.CrossRefGoogle Scholar
Gimode, WR, Kiboi, DM, Kimani, FT, Wamakima, HN, Burugu, MW and Muregi, FW (2015) Fitness cost of resistance for lumefantrine and piperaquine-resistant Plasmodium berghei in a mouse model. Malaria Journal 14, 38.CrossRefGoogle ScholarPubMed
Hoelder, S, Clarke, PA and Workman, P (2012) Discovery of small molecule cancer drugs: successes, challenges and opportunities. Molecular Oncology 6, 155176.CrossRefGoogle ScholarPubMed
Homan, WL, Vercammen, M, Braekeleer, JD and Verschueren, H (2000) Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. International Journal for Parasitology 30, 6975.CrossRefGoogle ScholarPubMed
Hou, N, Piao, XY, Liu, S, Wu, C and Chen, QJ (2015) Tim-3 induces Th2-biased immunity and alternative macrophage activation during Schistosoma japonicum infection. Infection and Immunity 83, 30743082.CrossRefGoogle ScholarPubMed
Kavitha, N, Noordin, R, Chan, KL and Sasidharan, S (2010) Cytotoxicity activity of root extract/fractions of Eurycoma longifolia Jack root against Vero and Hs27 cells. Journal of Medicinal Plants Research 4, 23832387.Google Scholar
Kim, YA, Sharon, A, Chu, CK, Rais, RH, Al-Safarjalani, ON, Naguib, FN and El-Kouni, MH (2007) Synthesis, biological evaluation and molecular modeling studies of N6-benzyladenosine analogues as potential anti-toxoplasma agents. Biochemical Pharmacology 73, 15581572.CrossRefGoogle ScholarPubMed
Kokwaro, G, Mwai, L and Nzila, A (2007) Artemether/lumefantrine in the treatment of uncomplicated falciparum malaria. Expert Opinion on Pharmacotherapy 8, 7594.CrossRefGoogle ScholarPubMed
Maji, C, Goel, P, Suthar, A, Mandal, KD, Gopalakrishnan, A, Kumar, R, Tripathi, BN and Kumar, S (2019) Lumefantrine and o-choline – parasite metabolism specific drug molecules inhibited in vitro growth of Theileria equi and Babesia caballi in MASP culture system. Ticks and Tick-Borne Diseases 10, 568574.CrossRefGoogle ScholarPubMed
Meneceur, P, Bouldouyre, MA, Aubert, D, Villena, I, Menotti, J, Sauvage, V, Garin, JF and Derouin, F (2008) In vitro susceptibility of various genotypic strains of Toxoplasma gondii to pyrimethamine, sulfadiazine, and atovaquone. Antimicrobial Agents and Chemotherapy 52, 12691277.CrossRefGoogle ScholarPubMed
Montoya, JG and Liesenfeld, O (2004) Toxoplasmosis. Lancet (London, England) 363, 19651976.CrossRefGoogle ScholarPubMed
Olliaro, PL and Trigg, PI (1995) Status of antimalarial drugs under development. Bulletin of the World Health Organization 73, 565571.Google ScholarPubMed
Patil, S, Suryavanshi, S, Pathak, S, Sharma, S and Patravale, V (2013) Evaluation of novel lipid based formulation of β-artemether and lumefantrine in murine malaria model. International Journal of Pharmacology 455, 229234.CrossRefGoogle ScholarPubMed
Pratama, DAOA, Biotech, S and Artama, WT (2015) Analysis of Toxoplasma gondii repeat region 529 bp (NCBI Acc. No. AF146527) as a probe candidate for molecular diagnosis of toxoplasmosis. Indonesian Journal of Biotechnology 14, 11241131.Google Scholar
Qin, SY, Cong, W, Liu, Y, Li, N, Wang, ZD, Zhang, FK, Huang, SY, Zhu, XQ and Liu, Q (2014) Molecular detection and genotypic characterization of Toxoplasma gondii infection in bats in four provinces of China. Parasites & Vectors 7, 558.CrossRefGoogle ScholarPubMed
Richard, MH, Pauline, BK, Mohammed, L, Concepta, M, Michael, A, Warunee, H, Nicholas, PJ, Nicholas, JW, Angela, A and Joel, T (2014) Artemether-lumefantrine co-administration with antiretrovirals: population pharmacokinetics and dosing implications. British Journal of Clinical Pharmacology 79, 636649.Google Scholar
Sepulveda-Arias, JC, Veloza, LA and Mantilla-Muriel, LE (2014) Anti-Toxoplasma activity of natural products: a review. Recent Patents on Anti-Infective Drug Discovery 9, 186194.CrossRefGoogle ScholarPubMed
Subauste, CS and Remington, JS (1993) Immunity to Toxoplasma gondii. Current opinion in Immunology 5, 532537.CrossRefGoogle ScholarPubMed
Tian, YM, Dai, FY, Huang, SY, Deng, ZH, Duan, G, Zhou, DH, Yang, JF, Weng, YB, Zhu, XQ and Zou, FC (2012) First report of Toxoplasma gondii seroprevalence in peafowls in Yunnan Province, Southwestern China. Parasites & Vectors 5, 205.CrossRefGoogle ScholarPubMed
Torre, A, Stanford, M, Curi, A, Jaffe, GJ and Gomez-Marin, JE (2011) Therapy for ocular toxoplasmosis. Ocular Immunology and Inflammation 19, 314320.CrossRefGoogle Scholar
Wang, DW, Liu, Y, Jiang, TT, Zhang, GX, Yuan, GM, He, JB, Su, CL and Yang, N (2016) Seroprevalence and genotypes of Toxoplasma gondii isolated from pigs intended for human consumption in Liaoning province, northeastern China. Parasites & Vectors 9, 248.CrossRefGoogle ScholarPubMed
White, NJ, Vugt, MV and Ezzet, F (1999) Clinical pharmacokinetics and pharmacodynamics and pharmacodynamics of artemether-lumefantrine. Clinical Pharmacokinetics 37, 105125.CrossRefGoogle ScholarPubMed
WHO (2010) Guidelines for the Treatment of Malaria. Geneva: World Health Organization.Google Scholar
WorldWide Antimalarial Resistance Network (WWARN) Lumefantrine PK/PD Study Group (2015) Artemether-lumefantrine treatment of uncomplicated Plasmodium falciparum malaria: a systematic review and meta-analysis of day 7 lumefantrine concentrations and therapeutic response using individual patient data. BMC Medicine 13, 227.CrossRefGoogle Scholar
Xi, XR (ed.) (2006) Analytical Chemistry. Beijing: China Press of Traditional Chinese Medicine.Google Scholar
Yin, Q, El-Ashram, S, Liu, H, Sun, X, Zhao, X, Liu, X and Suo, X (2015 a) Interferon-gamma release assay: an effective tool to detect early Toxoplasma gondii infection in mice. PLoS One 10, e0137808.CrossRefGoogle ScholarPubMed
Yin, Q, El-Ashram, S, Liu, XY and Suo, X (2015 b) Early detection of Toxoplasma gondii-infected cats by interferon-gamma release assay. Experimental Parasitology 157, 145149.CrossRefGoogle ScholarPubMed
Zhang, X, Jin, L, Cui, Z, Zhang, C, Wu, X, Park, H, Quan, H and Jin, C (2016) Antiparasitic effects of oxymatrine and matrine against Toxoplasma gondii in vitro and in vivo. Experimental Parasitology 165, 95102.CrossRefGoogle ScholarPubMed
Zheng, B, Ding, JZ, Lou, D, Tong, QB, Zhuo, XH, Ding, HJ, Kong, QM and Lu, SH (2019 a) The virulence-related MYR1 protein of Toxoplasma gondii as a novel DNA vaccine against toxoplasmosis in mice. Frontiers in Microbiology 10, 734.CrossRefGoogle ScholarPubMed
Zheng, B, Lou, D, Ding, JZ, Zhuo, XH, Ding, HJ, Kong, QM and Lu, SH (2019 b) GRA24-based DNA vaccine prolongs survival in mice challenged with a virulent Toxoplasma gondii strain. Frontiers in Microbiology 10, 418.Google ScholarPubMed
Zhou, P, Chen, Z, Li, HL, Zheng, H, He, S, Lin, RQ and Zhu, XQ (2011) Toxoplasma gondii infection in humans in China. Parasites & Vectors 4, 105.CrossRefGoogle ScholarPubMed
Figure 0

Fig. 1. Effects of lumefantrine and sulphadiazine on Toxoplasma gondii proliferation. After 2 h pre-treatment of tachyzoites, Vero cells were separately treated with lumefantrine or sulphadiazine for other 24 and 48 h, respectively. Tachyzoites treated with DMEM only were defined as the negative control and those treated with sulphadiazine (10 mg L−1) as the positive control. The inhibition rates of T. gondii proliferation were calculated by the formula: (Group treatments OD − Group DMEM OD)/Group DMEM OD. Data represent mean ± s.d. of three independent experiments performed in triplicate. Significantly different from the negative control (compared with DMEM group, **P ≤ 0.01, *P ≤ 0.05).

Figure 1

Fig. 2. Lumefantrine inhibition of proliferation of T. gondii at 24 h post-treatment by flow cytometry. Tachyzoites were treated with lumefantrine for 24 h. Vero cells treated with DMEM only were defined as the blank control, and tachyzoites treated with DMEM only were defined as the negative control. As a positive control, tachyzoites were treated with sulphadiazine. Samples were stained with annexin V-FITC and propidium iodide, and the percentage of Vero cells in each group was determined by FCM. (a) Results of lumefantrine inhibit proliferation of T. gondii by FCM; (b) histogram based on the number of living Vero cells in the Q3 quadrant by FCM. Data represent mean ± s.d. of three independent experiments performed in triplicate. Significantly different from the negative control (compared with negative group, **P ≤ 0.01, *P ≤ 0.05).

Figure 2

Fig. 3. Effect of lumefantrine on the survival rate of acutely infected mice. All the mice were infected with 100 T. gondii tachyzoites and then treated with lumefantrine (50, 9.375 or 1.563 μg L−1), a positive control (10 mg L−1 sulphadiazine) and PBS (negative control) every 2 days for 10 days. The uninfected control mice were served as blank group, and T. gondii infected-mice treated with PBS only were as the negative group. Mice were observed daily, and the survival rate was recorded for 11 days post-infection.

Figure 3

Fig. 4. Parasite burden in tissues from the acutely infected mice. Mice were challenged intraperitoneally with 100 T. gondii tachyzoites, treated with lumefantrine (50, 9.375 or 1.563 μg L−1), a positive drug (10 mg L−1 sulphadiazine) and PBS (negative control) every 2 days for 10 days. The uninfected control mice were served as blank group, and T. gondii infected-mice treated with PBS only were as the negative group. The parasite loads in the liver, heart, spleen and lung tissues of the infected mice were isolated and homogenized. Total RNA was isolated, and the T. gondii repeat region was detected by qPCR. The quantified parasite loads in the tissues of mice are presented as the fold change of −log10 values of the numbers of tachyzoites per 20 mg of tissues. Data represent mean ± s.d. of three independent experiments performed in triplicate. Significantly different from the negative control (compared with negative group, **P ≤ 0.01, *P ≤ 0.05).

Figure 4

Fig. 5. Lumefantrine regulates the change of cytokines. Mice were challenged intraperitoneally with 100 T. gondii tachyzoites and treated with lumefantrine (50, 9.375 or 1.563 μg L−1), a positive drug (10 mg L−1 sulphadiazine) and PBS (negative control) every 2 days for 10 days. The uninfected control mice were served as blank group, and T. gondii infected-mice treated with PBS only were as the negative group. Sera of infected mice were collected at 11 days post-infection, and the cytokine levels were detected using a microplate reader. Cytokine levels were expressed as ng L−1 or pg mL−1. Three independent experiments were performed, and data are presented as mean ± s.d. Significantly different from the negative control (compared with negative group, **P ≤ 0.01, *P ≤ 0.05).

Supplementary material: Image

Wang et al. supplementary material

Figure S1

Download Wang et al. supplementary material(Image)
Image 2 MB
You have Access Open access

Save article to Kindle

To save this article to your Kindle, first ensure coreplatform@cambridge.org is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about saving to your Kindle.

Note you can select to save to either the @free.kindle.com or @kindle.com variations. ‘@free.kindle.com’ emails are free but can only be saved to your device when it is connected to wi-fi. ‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service.

Determination of lumefantrine as an effective drug against Toxoplasma gondii infection – in vitro and in vivo study
Available formats
×

Save article to Dropbox

To save this article to your Dropbox account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you used this feature, you will be asked to authorise Cambridge Core to connect with your Dropbox account. Find out more about saving content to Dropbox.

Determination of lumefantrine as an effective drug against Toxoplasma gondii infection – in vitro and in vivo study
Available formats
×

Save article to Google Drive

To save this article to your Google Drive account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you used this feature, you will be asked to authorise Cambridge Core to connect with your Google Drive account. Find out more about saving content to Google Drive.

Determination of lumefantrine as an effective drug against Toxoplasma gondii infection – in vitro and in vivo study
Available formats
×
×

Reply to: Submit a response

Please enter your response.

Your details

Please enter a valid email address.

Conflicting interests

Do you have any conflicting interests? *