Skip to main content Accessibility help
×
Home
Hostname: page-component-559fc8cf4f-6pznq Total loading time: 0.397 Render date: 2021-03-05T05:09:55.629Z Has data issue: true Feature Flags: { "shouldUseShareProductTool": true, "shouldUseHypothesis": true, "isUnsiloEnabled": true, "metricsAbstractViews": false, "figures": false, "newCiteModal": false, "newCitedByModal": true }

Impact of the STAT1 N-terminal domain for fibrosarcoma cell responses to ɣ-irradiation

Subject: Life Science and Biomedicine

Published online by Cambridge University Press:  09 July 2020

Anja Göder
Affiliation:
Department of Toxicology, University Medical Center, Obere Zahlbacher Str. 67, 55131 Mainz, Germany
Torsten Ginter
Affiliation:
Center for Molecular Biomedicine (CMB), Institute for Biochemistry, Friedrich-Schiller University Jena, Hans-Knöll Str. 2, 07745 Jena, Germany
Ulrike Kröhnert
Affiliation:
Center for Molecular Biomedicine (CMB), Institute for Biochemistry, Friedrich-Schiller University Jena, Hans-Knöll Str. 2, 07745 Jena, Germany
Christian Kosan
Affiliation:
Center for Molecular Biomedicine (CMB), Institute for Biochemistry, Friedrich-Schiller University Jena, Hans-Knöll Str. 2, 07745 Jena, Germany
Oliver H. Krämer
Affiliation:
Department of Toxicology, University Medical Center, Obere Zahlbacher Str. 67, 55131 Mainz, Germany
Corresponding
E-mail address:

Abstract

Type I/II interferons (IFNα,β/IFNɣ) are cytokines that activate signal-transducer-and-activator-of-transcription-1 (STAT1). The STAT1 N-terminal domain (NTD) mediates dimerization and cooperative DNA-binding. The STAT1 DNA-binding domain (DBD) confers sequence-specific DNA-recognition. STAT1 has been connected to growth inhibition, replication stress and DNA-damage. We investigated how STAT1 and NTD/DBD mutants thereof affect fibrosarcoma cells. STAT1 and indicated mutants do not affect proliferation of resting and IFNα-treated cells as well as checkpoint kinase signaling, and phosphorylation of the tumor-suppressive transcription factor p53 ensuing ɣ-irradiation. Of the STAT1 reconstituted U3A cells those with STAT1 NTD mutants accumulate the highest levels of the replication stress/DNA-damage marker S139-phosphorylated histone H2AX (ɣH2AX). This is similarly seen with a STAT1 NTD/DBD double mutant, indicating transcription-independent effects. Furthermore, U3A cells with STAT1 NTD mutants are most susceptible to apoptotic DNA fragmentation and cleavage of the DNA repair protein PARP1. These data provide novel insights into the relevance of the STAT1 NTD.

Type
Research Article
Information
Creative Commons
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted re-use, distribution, and reproduction in any medium, provided the original work is properly cited.
Copyright
© The Author(s), 2020. Published by Cambridge University Press

Highlights:

  • STAT1 and NTD mutants can be stably expressed in U3A cells

  • Similar effects of wild-type and mutant STAT1 on proliferation ± IFNα

  • STAT1FA accentuates ɣH2AX accumulation and apoptosis upon ɣ-irradiation

Introduction

Binding of cytokines and growth hormones to cognate receptors activates the inducible transcription factors STAT1,-2,-3,-4,-5A,-5B,-6. STATs have a modular structure (NTD, coiled-coil, DBD, linker, SH2-domain, p-tyrosine site, C-terminal activation domain) (Khodarev et al., Reference Khodarev, Roizman and Weichselbaum2012; Wieczorek et al., Reference Wieczorek, Ginter, Brand, Heinzel and Krämer2012). STAT1 phosphorylation at Y701 leads to high affinity interactions with other STATs. The NTD allows cooperative STAT1-STAT1/STAT1-STAT2 DNA-binding of pre-formed dimers and enables STAT1 dephosphorylation (Mertens et al., Reference Mertens, Zhong, Krishnaraj, Zou, Chen and Darnell2006; Wieczorek et al., Reference Wieczorek, Ginter, Brand, Heinzel and Krämer2012).

IFN-/STAT1-related signatures promote resistance to chemotherapy and ɣ-irradiation in cancer cells (Ah-Koon et al., Reference Ah-Koon, Lesage, Lemadre, Souissi, Fagard, Varin-Blank, Fabre and Schischmanoff2016; Kaowinn et al., Reference Kaowinn, Jun, Kim, Shin, Hwang, Kim, Shin, Kaewpiboon, Jeong, Koh, Krämer, Johnston and Chung2017; Khodarev et al., Reference Khodarev, Roizman and Weichselbaum2012; Malilas et al., Reference Malilas, Koh, Kim, Srisuttee, Cho, Moon, Yoo, Oh, Johnston and Chung2013). Intriguingly, STAT1 can though promote sensitivity to DNA crosslinking agents (Prieto-Remon et al., Reference Prieto-Remon, Sanchez-Carrera, Lopez-Duarte, Richard and Pipaón2013) and pro-apoptotic gene expression (Khodarev et al., Reference Khodarev, Roizman and Weichselbaum2012; Wieczorek et al., Reference Wieczorek, Ginter, Brand, Heinzel and Krämer2012). Hence, modulators of STAT1 may be novel and innovative context-dependent anti-cancer drugs (Khodarev et al., Reference Khodarev, Roizman and Weichselbaum2012).

Objective

It is unclear whether the STAT1 NTD and DBD modulate cellular responses to fibrosarcoma cell growth and their responses to IFNα and ɣ-irradiation. We set out to answer these questions. We reconstituted STAT1 negative U3A fibrosarcoma cells with wild-type STAT1 and NTD/DBD mutants thereof. We investigated cellular responses and molecular parameters.

Material and Methods

Cell lines

Cells were cultured as described (Ginter et al., Reference Ginter, Bier, Knauer, Sughra, Hildebrand, Münz, Liebe, Heller, Henke, Stauber, Reichardt, Schmid, Kubatzky, Heinzel and Krämer2012) and table 1:. See figure legends for ɣ-irradiation.

Plasmids

We refer to HA-tagged STAT1α as STAT1. STAT1AA has moieties phenylalanine-77 and leucine-78 replaced by alanine moieties (mutagenic primers 5-GCTTTTCTTTGGAGAATAACGCCGCGC TACAGCATAACATAAGG-3/5-CCTTATGTTATGCTG TAGCGCGGCGTTATTCTCCAAAGAAAA GCG-3). STAT1AAQQ carries these mutations and additional lysine-410 and lysine-413 exchanges to glutamine residues (Ginter et al., Reference Ginter, Bier, Knauer, Sughra, Hildebrand, Münz, Liebe, Heller, Henke, Stauber, Reichardt, Schmid, Kubatzky, Heinzel and Krämer2012).

Western blot, immunoprecipitation, antibodies, drugs, chemicals, cytokines

For Western blot technique see (Beyer et al., Reference Beyer, Kiweler, Mahboobi and Krämer2017). Antibodies: Santa-Cruz-Biotechnology (β-actin/sc-47,778;p53/sc-81,168;IFNAR/sc-845; STAT1/sc-346/sc-417; p-STAT1/sc-7,988-R); Sigma (tubulin-α/T5168); Abgent (UBCH8/AP2118b); BD-Pharmingen (cleaved PARP1/552596); Abcam (ATM/ab32420;p-S1981-ATM/ab81292); Cell-Signalling (ATR/2790;CHK1/2360;p-S317-CHK1/2344;CHK2/2662;p-T68-CHK2/2661;p-S15-p53/9284;γH2AX/9718); Millipore (53BP1/NAB3802). For immunoprecipitation, drugs, chemicals, and cytokines see (Ginter et al., Reference Ginter, Bier, Knauer, Sughra, Hildebrand, Münz, Liebe, Heller, Henke, Stauber, Reichardt, Schmid, Kubatzky, Heinzel and Krämer2012). Immunoblot data show results from at least two independent experiments.

Cell cycle and apoptotic DNA fragmentation analyses

Cells were incubated with 103 U/ml IFNα or 10 Gy using a Gammacell 2000 irradiator. Adherent and floating cells were collected. Single-cell suspensions in PBS were centrifuged (5 min, 700xg, RT). Pellets were fixed (1 ml ice cold 70% ethanol), stored at −20 °C overnight, and washed in 1 ml PBS (5 min at 700xg, RT). Per sample, 390 μl PBS, 5 μl RNase A (10 mg/ml), and 5 μl PI (2.5 mg/ml) were added (20 min, 37 °C). Samples were analyzed by flow cytometry.

Results

STAT1 and NTD/DBD mutants do not impair growth

We investigated if IFNα-activated STAT1 has anti-proliferative effects in U3A cells. STAT1 (WT) and STAT1AA (lacks NTD for dimerization and cooperative DNA binding (Mertens et al., Reference Mertens, Zhong, Krishnaraj, Zou, Chen and Darnell2006)) bound to the IFNα-receptor (IFNAR) (Fig. 1A). However, IFNα did not affect the cell cycle of U3A cells reconstituted with STAT1 or NTD (AA)/DBD (QQ) mutants (Table 1: and Fig. 1B-D).

(A) HA-tagged STAT1 or STAT1AA were transfected into HEK 293 T cells. 24 h later, the cells were stimulated with 1,000 U IFNα for 1 h. Lysates were collected and subjected to immunoprecipitation against IFNAR. Western blots were probed for immunoprecipitated IFNAR and bound HA-tagged STAT1 variants; * non-specific band resulting from IgG. (B) Detection of wild-type STAT1 and mutants thereof in reconstituted U3A fibrosarcoma cells. Equal amounts of lysates from untreated and IFNɣ-treated (10 ng/ml, 24 h) U3A cells were probed for STAT1 by Western blot. HEK 293 T cells served as controls expressing the endogenous STAT1 gene (encoding STAT1α and STAT1β) which is induced upon IFN treatment. (C) U3A cells stably expressing STAT1 (WT, wild-type), STAT1 GFP, STAT1K410/413Q (QQ) and/or STAT1F77A/L78A (AA) were treated with 1,000 U IFNα (+, red lines) or were kept untreated (−, black lines) for 96 h. Cell cycle analysis was performed using propidium iodide (PI) staining on fixed cells. The cell cycle phases are marked for GFP-transfected cells as an example (G1, G1 phase; S, S phase; G2, G2/M phase). Graphs are representative for n = 3.(D) Same as in (C), bar graphs show the average percentages of cells in G1, S and G2/M cell cycle phase. Data represent three independent experiments, of which one is shown as (C). Error bars indicate standard deviations. No statistically significant differences were seen (t-test).

Figure 1. IFNs do not restrict the growth of fibrosarcoma cells ± STAT1.

ɣ-irradiation differentially affects U3A cells with STAT1 and its mutants

γ-irradiation evoked the accumulation of a subG1 fraction (Fig. 2A) and of cleaved PARP1 more pronouncedly in cells with STAT1AA and STAT1AAQQ (Fig. 2B). Apparently, ɣ-irradiation causes apoptosis and STAT1 accentuates this.

(A) U3A cells stably expressing STAT1, GFP, STAT1K410/413Q (QQ) and/or STAT1F77A/L78A (AA) were irradiated with 10 Gy ionizing radiation (+) or kept untreated (−). This was followed by an incubation at 37 °C for 48 h or 72 h. SubG1 fractions were assessed via flow cytometry and PI staining. Data represent three (48 h) or four (72 h) independent experiments. Two-way ANOVA, Šidák multiple comparisons test, error bars indicate standard deviations; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.(B) U3A cells were treated as described in (A) for 72 h. Whole cell extracts were prepared and indicated proteins were detected by SDS-PAGE and Western blot analysis. Both adherent and floating cells were harvested for immunoblot and flow cytometry (n = 2).

Figure 2. STAT1 sensitizes fibrosarcoma cells to cytotoxic effects of γ-irradiation.

STAT1 NTD affects ɣH2AX accumulation upon ɣ-irradiation

Next, we analyzed DNA damage sensors. 53BP1 levels were not correlated with STAT1 per se (Fig. 3A). Apical (ATM/ATR) and downstream checkpoint kinases (CHK1/CHK2) and their target p53 were phosphorylated after ɣ-irradiation irrespective of STAT1 (Fig. 3B, C). In contrast, the checkpoint kinase target ɣH2AX accumulated most pronouncedly in U3A cells with STAT1AA/STAT1AAQQ (Fig. 3C). Hence, NTD mutant STAT1 expression correlates with irradiation-induced ɣH2AX.

(A) 53BP1 is a key regulator of DNA double-strand breaks processing and their repair by the non-homologous end-joining DNA repair pathway. U3A cells stably expressing STAT1, GFP, STAT1K410/413Q (QQ) and/or STAT1F77A/L78A (AA) were analyzed for 53BP1; HSP90 as loading control. 2fTGH cells (STAT1 positive parental cells for U3A cells) and HEK 293 T cells served as controls with endogenous STAT1. (B) U3A cells stably expressing STAT1, GFP, STAT1K410,413Q (QQ) and/or STAT1F77A, L78A (AA) and HEK293T cells were irradiated with 10 Gy ionizing radiation (+) or kept untreated (−). After 2 h, cells were harvested, lysed and samples were analyzed via Western blot for checkpoint kinase phosphorylation (pS1981-ATM, pT68-CHK2, pS317-CHK1) and total levels (n = 4). (C) Same as in (B), but analysis of S15-phosphorylated and total p53 and ɣH2AX; β-actin as loading control. Both adherent and floating cells were harvested for immunoblot (n = 3).

Figure 3. STAT1 does not alter checkpoint kinase signaling after ɣ-irradiation.

Discussion

STAT1 sensitizes fibrosarcoma cells to DNA damage and apoptosis upon ɣ-irradiation. Cooperativity through the STAT1 NTD seems to attenuate this. Thus, STAT1 signaling could be analyzed further as a target in fibrosarcoma and potentially other cancers. Fibrosarcoma is a clinically unmet problem with poor survival due to resistance to chemotherapy and irradiation as well as tumor recurrence after surgery. Novel treatments and the identification of mechanisms that regulate the therapeutic sensitivity of fibrosarcoma could solve the clinical problem (Augsburger et al., Reference Augsburger, Nelson, Kalinski, Udelnow, Knösel, Hofstetter, Qin, Wang, Gupta, Bonifatius, Li, Bruns and Zhao2017). Perhaps, STAT1 is both a clinically applicable marker and novel agents targeting the STAT1 NTD might give therapeutic benefits.

Conclusion

Our work provides fresh information on the relevance of STAT1 and a limited number of NTD/DBD mutants thereof for cellular responses to IFNα and ɣ-irradiation. We speculate that the higher levels of ɣH2AX in U3A cells with STAT1AA/AAQQ result from attenuated DNA repair and/or apoptosis. It is plausible that the non-cooperative STAT1 NTD mutants have binding partners that are not engaged by the dimerization-competent wild-type STAT1. Future studies are needed to reveal if such proteins might be DNA repair proteins and/or transcription factors.

Acknowledgement

We thank Sigrid Reichardt for technical assistance and Prof. Dr. T. Heinzel for helpful discussions. Moreover, we are indebted to Prof. Dr. Darnell for the HA-STAT1 plasmid.

Funding Information

Funding was from intramural funds (University Medical Center Mainz and CMB Jena).

Conflicts of interest

All authors (A.G., T.G., U.K., C.K., OH.K.) declare no conflicts of interest.

Authors contributions.

A.G., T.G., U.K. conducted data gathering.

A.G., C.K. performed statistical analyses.

A.G., O.H.K. conceived and designed the study.

OH.K. wrote the article.

Data availability statement

The data that support the findings of this study are available from the corresponding author, O.H.K., upon reasonable request.

Footnotes

present address: Centre for Chromosome Biology, School of Natural Sciences, National University of Ireland Galway, Ireland

References

Ah-Koon, L., Lesage, D., Lemadre, E., Souissi, I., Fagard, R., Varin-Blank, N., Fabre, E. E., & Schischmanoff, O. (2016). Cellular response to alkylating agent MNNG is impaired in STAT1-deficients cells. Journal of Cell and Molecular Medicine, 20, 19561965.CrossRefGoogle ScholarPubMed
Augsburger, D., Nelson, P. J., Kalinski, T., Udelnow, A., Knösel, T., Hofstetter, M., Qin, J. W., Wang, Y., Gupta, A. S., Bonifatius, S., Li, M., Bruns, C. J., & Zhao, Y. (2017). Current diagnostics and treatment of fibrosarcoma—Perspectives for future therapeutic targets and strategies. Oncotarget, 8, 104638104653.CrossRefGoogle ScholarPubMed
Beyer, M., Kiweler, N., Mahboobi, S., & Krämer, O. H. (2017). How to Distinguish Between the Activity of HDAC1-3 and HDAC6 with Western Blot. Methods in Molecular Biology, 1510, 355364.CrossRefGoogle ScholarPubMed
Ginter, T., Bier, C., Knauer, S. K., Sughra, K., Hildebrand, D., Münz, T., Liebe, T., Heller, R., Henke, A., Stauber, R. H., Reichardt, W., Schmid, J. A., Kubatzky, K. F., Heinzel, T., & Krämer, O. H. (2012). Histone deacetylase inhibitors block IFNgamma-induced STAT1 phosphorylation. Cell Signalling, 24, 14531460.CrossRefGoogle ScholarPubMed
Kaowinn, S., Jun, S. W., Kim, C. S., Shin, D.-M., Hwang, Y.-H., Kim, K., Shin, B., Kaewpiboon, C., Jeong, H. H., Koh, S. S., Krämer, O. H., Johnston, R. N., & Chung, Y.-H. (2017). Increased EGFR expression induced by a novel oncogene, CUG2, confers resistance to doxorubicin through Stat1-HDAC4 signaling. Cellular Oncology, 40, 549561.CrossRefGoogle ScholarPubMed
Khodarev, N. N., Roizman, B., & Weichselbaum, R. R. (2012). Molecular pathways: Interferon/stat1 pathway: Role in the tumor resistance to genotoxic stress and aggressive growth. Clinical Cancer Research, 18, 30153321.CrossRefGoogle ScholarPubMed
Malilas, W., Koh, S. S., Kim, S., Srisuttee, R., Cho, I.-R., Moon, J., Yoo, H.-S., Oh, S., Johnston, R. N., & Chung, Y.-H. (2013). Cancer upregulated gene 2, a novel oncogene, enhances migration and drug resistance of colon cancer cells via STAT1 activation. International Journal of Oncology, 43, 11111116.CrossRefGoogle ScholarPubMed
Mertens, C., Zhong, M., Krishnaraj, R., Zou, W., Chen, X., & Darnell, J. E. Jr. (2006). Dephosphorylation of phosphotyrosine on STAT1 dimers requires extensive spatial reorientation of the monomers facilitated by the N-terminal domain. Genes & Development, 20, 33723381.CrossRefGoogle ScholarPubMed
Prieto-Remon, I., Sanchez-Carrera, D., Lopez-Duarte, M., Richard, C., & Pipaón, C. (2013). Elevated levels of STAT1 in Fanconi anemia group A lymphoblasts correlate with the cells' sensitivity to DNA interstrand crosslinking drugs. Haematologica, 98, 705713.CrossRefGoogle Scholar
Wieczorek, M., Ginter, T., Brand, P., Heinzel, T., & Krämer, O. H. (2012). Acetylation modulates the STAT signaling code. Cytokine & Growth Factor Reviews, 23, 293305.CrossRefGoogle ScholarPubMed
Reviewing editor:  Martin Michaelis University of Kent, School of Biosciences, Canterbury, United Kingdom of Great Britain and Northern Ireland, CT2 7NJ
This article has been accepted because it is deemed to be scientifically sound, has the correct controls, has appropriate methodology and is statistically valid, and met required revisions.

Review 1: Impact of the STAT1 N-terminal domain for fibrosarcoma cell responses to ɣ-irradiation

Conflict of interest statement

The reviewer shares a secondary affiliation with one of the co-authors of the manuscript.

Comments

Comments to the Author: The manuscript represents a congruent set of experimental results. There are some minor issues that should be addressed prior to acceptance:- Introduce STAT1AAQQ in the methods section- Fig. 1D. Indicate the number of biological/technical repeats and the statistical test employed- indicate the number of biological repeats performed for the WB analyses shown (e.g. “The results are representative of n biological repeats”)

Presentation

Overall score 4.3 out of 5
Is the article written in clear and proper English? (30%)
4out of5
Is the data presented in the most useful manner? (40%)
4out of5
Does the paper cite relevant and related articles appropriately? (30%)
5out of5

Context

Overall score 4.5 out of 5
Does the title suitably represent the article? (25%)
5out of5
Does the abstract correctly embody the content of the article? (25%)
5out of5
Does the introduction give appropriate context? (25%)
4out of5
Is the objective of the experiment clearly defined? (25%)
4out of5

Analysis

Overall score 3.6 out of 5
Does the discussion adequately interpret the results presented? (40%)
4out of5
Is the conclusion consistent with the results and discussion? (40%)
3out of5
Are the limitations of the experiment as well as the contributions of the experiment clearly outlined? (20%)
4out of5

Review 2: Impact of the STAT1 N-terminal domain for fibrosarcoma cell responses to ɣ-irradiation

Conflict of interest statement

Reviewer declares none

Comments

Comments to the Author: The manuscript reports thorough piece of work investigating the role of STAT1 in fibrosarcoma. The manuscript is clear and provides findings that will be of interest to the field.

Presentation

Overall score 5 out of 5
Is the article written in clear and proper English? (30%)
5out of5
Is the data presented in the most useful manner? (40%)
5out of5
Does the paper cite relevant and related articles appropriately? (30%)
5out of5

Context

Overall score 5 out of 5
Does the title suitably represent the article? (25%)
5out of5
Does the abstract correctly embody the content of the article? (25%)
5out of5
Does the introduction give appropriate context? (25%)
5out of5
Is the objective of the experiment clearly defined? (25%)
5out of5

Analysis

Overall score 4.8 out of 5
Does the discussion adequately interpret the results presented? (40%)
5out of5
Is the conclusion consistent with the results and discussion? (40%)
5out of5
Are the limitations of the experiment as well as the contributions of the experiment clearly outlined? (20%)
4out of5

Full text views

Full text views reflects PDF downloads, PDFs sent to Google Drive, Dropbox and Kindle and HTML full text views.

Total number of HTML views: 109
Total number of PDF views: 112 *
View data table for this chart

* Views captured on Cambridge Core between 09th July 2020 - 5th March 2021. This data will be updated every 24 hours.

Access
Open access

Send article to Kindle

To send this article to your Kindle, first ensure no-reply@cambridge.org is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about sending to your Kindle. Find out more about sending to your Kindle.

Note you can select to send to either the @free.kindle.com or @kindle.com variations. ‘@free.kindle.com’ emails are free but can only be sent to your device when it is connected to wi-fi. ‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service.

Impact of the STAT1 N-terminal domain for fibrosarcoma cell responses to ɣ-irradiation
Available formats
×

Send article to Dropbox

To send this article to your Dropbox account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Dropbox.

Impact of the STAT1 N-terminal domain for fibrosarcoma cell responses to ɣ-irradiation
Available formats
×

Send article to Google Drive

To send this article to your Google Drive account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Google Drive.

Impact of the STAT1 N-terminal domain for fibrosarcoma cell responses to ɣ-irradiation
Available formats
×
×

Reply to: Submit a response


Your details


Conflicting interests

Do you have any conflicting interests? *