Skip to main content Accessibility help
Hostname: page-component-79b67bcb76-wlt4x Total loading time: 0.3 Render date: 2021-05-13T20:55:37.613Z Has data issue: true Feature Flags: { "shouldUseShareProductTool": true, "shouldUseHypothesis": true, "isUnsiloEnabled": true, "metricsAbstractViews": false, "figures": false, "newCiteModal": false, "newCitedByModal": true, "newEcommerce": true }

Temporal and spatial variation in Anaplasma phagocytophilum infection in Swedish moose (Alces alces)

Published online by Cambridge University Press:  04 September 2013

Department of Pathology and Wildlife Diseases, National Veterinary Institute, Uppsala, Sweden Division of Reproduction, Department of Clinical Sciences, Swedish University of Agricultural Sciences, Uppsala, Sweden
Division of Reproduction, Department of Clinical Sciences, Swedish University of Agricultural Sciences, Uppsala, Sweden Section of Bacteriology and Food Safety, Department of Biomedical Sciences and Veterinary Public Health, Swedish University of Agricultural Sciences, Uppsala, Sweden
Biomathematics and Statistics Scotland, University of Edinburgh, Edinburgh, UK
University of Nottingham School of Veterinary Medicine & Science, Sutton Bonington, UK Twycross Zoo (East Midlands Zoological Society), Atherstone, UK
Disease Systems, Scottish Agricultural College, Edinburgh, UK
Centre for Fish and Wildlife Research, Department of Wildlife, Fish, and Environmental Studies, Swedish University of Agricultural Sciences, Umeå, Sweden
Department of Pathology and Wildlife Diseases, National Veterinary Institute, Uppsala, Sweden
Department of Bacteriology, National Veterinary Institute, Uppsala, Sweden
Department of Production Animal Clinical Sciences, Norwegian School of Veterinary Science, Oslo, Norway
Department of Pathology and Wildlife Diseases, National Veterinary Institute, Uppsala, Sweden
E-mail address:
Rights & Permissions[Opens in a new window]


The occurrence of Anaplasma phagocytophilum was investigated in spleen and serum samples from Swedish moose (Alces alces) in southern Sweden (island and mainland). Samples were analysed for presence of A. phagocytophilum DNA by real-time PCR (n = 263), and for Anaplasma antibodies with ELISA serology (n = 234). All serum samples had antibodies against A. phagocytophilum. The mean DNA-based prevalence was 26·3%, and significant (P < 0·01) temporal, and spatial variation was found. Island moose had significantly (P < 0·001) higher prevalence of A. phagocytophilum DNA than moose from the mainland areas. Two samples were sequenced to determine genetic variation in the 16S rRNA and groESL genes. Genetic sequence similarity with the human granulocytic anaplasmosis agent, equine granulocytic ehrlichiosis agent, and different wildlife-associated A. phagocytophilum variants were observed in the 16S rRNA and groESL genes. Our study shows that moose are exposed to A. phagocytophilum in Sweden, and represent a potential wildlife reservoir of the pathogen.

Original Papers
Creative Commons
Creative Common License - CCCreative Common License - BYCreative Common License - NCCreative Common License - SA
The online version of this article is published within an Open Access environment subject to the conditions of the Creative Commons Attribution licence <>.
Copyright © Cambridge University Press 2013


Anaplasma phagocytophilum is a widespread tick-borne pathogen reported to infect various species of wild and domestic animals [Reference Woldehiwet1]. It is a Gram-negative, obligate intracellular bacterium of the order Rickettsiales that infects white blood cells (neutrophils, eosinophils, monocytes). The primary vectors are ticks including Ixodes ricinus (Europe [Reference Woldehiwet1]), Ixodes scapularis (eastern United States), and Ixodes pacificus (western United States) [Reference Teglas and Foley2]. In cattle and sheep, A. phagocytophilum infection can cause tick-borne fever (TBF), a disease characterized by fever, depression, lethargy, reduced milk yield (dairy cattle) and abortion [Reference Woldehiwet1]. In horses, infection with A. phagocytophilum (earlier known as Ehrlichia equi) may cause equine granulocytic ehrlichiosis [Reference Gribble3], and in humans it is a cause of human granulocytic anaplasmosis (HGA [Reference Chen4]). HGA is considered to be an emerging vector-borne infection in Europe [Reference Dumler5] and the USA [Reference Dumler5, Reference Thomas, Dumler and Carlyon6], and is reportedly under-diagnosed due to the similarity of its clinical symptoms with infection with Borrelia burgdorferi [Reference Thomas, Dumler and Carlyon6].

The epidemiology of A. phagocytophilum in wildlife is poorly understood, and few reports on the pathogenic potential of A. phagocytophilum infection in cervids exist. These include case reports of A. phagocytophilum-associated mortality in roe deer (Capreolus capreolus) fawns and a moose calf (Alces alces) from Norway [Reference Jenkins7Reference Stuen9]. In these reports, the animals succumbed due to a fatal, presumably secondary bacterial pneumonia, and the authors suggested that the immunosuppressive effects of a primary infection with A. phagocytophilum may have facilitated the lung infection. Seroprevalence in moose was reported to be 43% in a study in Norway [Reference Stuen10], but association with disease was not investigated. Another Norwegian study reported a 79% seroprevalence in moose from a habitat know to be tick-infested [Reference Milner and van Beest11]. Different genetic variants of A. phagocytophilum have been found in cervids based on 16S rRNA gene sequencing [Reference Petrovec12Reference Welc-Falęciak14]. Red deer (Cervus elaphus) in the Czech Republic reportedly carry two different 16S rRNA variants of A. phagocytophilum [Reference Zeman and Pecha15]. However, sequences of other less conserved genes such as msp4, groESL or anka from different A. phagocytophilum isolates revealed substantial variability [Reference Ladbury16Reference Stuen19]. For instance, up to 11 different variants of A. phagocytophilum based on the groESL gene sequences were detected in roe deer, red deer, alpine chamois (Rupicapra rupicapra), Alpine ibex (Capra ibex), and European mouflon (Ovis musimon) in Austria [Reference Silaghi13].

In 2005, a dead moose calf from the island of Öland in the Baltic Sea (Fig. 1) was submitted for post-mortem examination to the National Veterinary Institute in Uppsala, Sweden. The cause of death was a severe bacterial bronchopneumonia, with a concurrent septicaemia (caused by Streptococcus sp.). A. phagocytophilum DNA was detected by polymerase chain reaction (PCR) analysis [Reference Bernodt20]. It was suggested that the A. phagocytophilum infection facilitated the bacterial bronchopneumonia, resembling the findings of the report from Norway [Reference Jenkins7]. On the island of Öland local hunters have since 2006 reported low numbers of observed moose calves during the autumn hunt [21]. Several hunters on the island are also farmers (sheep, cattle), and frequently observe and treat their animals for tick-borne fever; similar information has been reported by local veterinarians [22]. Hence, it was suggested that infection with A. phagocytophilum had affected moose calf health and survival on the island.

Fig. 1. Map showing sampling areas (highlighted) in Sweden. A represents the island of Öland; B, C, and D represent sampling areas in three different mainland populations.

The epidemiology of A. phagocytophilum infection in moose populations based on both serological and PCR-based data has not been reported previously. The aim of the present study was to investigate the serological and DNA-based prevalence of A. phagocytophilum in hunter-harvested moose from the island of Öland, and three areas on the mainland of Sweden.


Samples from harvested moose were collected from the island of Öland (Fig. 1, area A; 2007–2010), and from three mainland populations (Fig. 1, areas B, C, D; 2008–2010) during the moose hunt in October and November. Area A, the island of Öland, is a habitat with a mix of agricultural land and deciduous forest in the southern part, and boreal forest in the northern parts. Areas B, C, and D consist of mostly boreal forest [Reference Nilsson and Cory23]. Trained field assistants collected fresh samples (spleen, kidney, liver, faeces, lower jaws, ectoparasites, rumen contents, blood) from harvested moose, according to a standardized protocol. Blood (primarily from vena cava caudalis or the heart) was collected in non-additive blood tubes (BD Vacutainer®, BD Diagnostics, USA). Serum was separated from the blood samples and stored at −20°C. A 4 × 4 cm piece of the spleen, mandibles, and remaining samples were stored at −20°C awaiting further analysis. The body condition (below normal or normal) based on the presence of coronary fat deposits and signs of muscular atrophy, was recorded, and a specific identity was assigned to each sampled moose. The hunters recorded the weight of the carcass after removal of skin, head, internal organs, and metapodials, according to Wallin [Reference Wallin24].

For age determination in adult moose, the first molar of the lower jaw was sectioned and cementum layers counted as described by Wolfe [Reference Wolfe25]. The animals were divided into three age groups: calf (<1 year), subadult (1–2 years), and adult (>2 years).

The screening for presence of A. phagocytophilum DNA was performed with a diagnostic commercial real-time PCR test for detection of 16S rDNA using GER3 (TAGATCCTTCTTAACGGAAGGGCG) and GER4 (AAGTGCCCGGCTTAACCCGCTGGC) primers as described by Goodman et al. [Reference Goodman26], but converted to a real-time PCR format by adding a TaqMan probe [Reference Jäderlund27]. Total DNA was extracted from spleen samples, excising a cube with sides of 0·5 cm, mashing the tissue with sterile scalpels, subsequently followed by lysis and DNA extraction according to the manufacturer's instructions, using the QIAamp DNA Extraction kit and an EZ1 BioRobot (Qiagen GmbH, Germany). PCR was performed according to Jäderlund et al. [Reference Jäderlund27] in an ABI 7500 FAST PCR machine (Life Technologies, USA), and was run for 40 cycles. Each PCR included a control with the DNA template substituted with sterile water, a positive and a negative reference A. phagocytophilum template, extracted from blood from A. phagocytophilum-infected and non-infected horses, respectively. To prevent contamination from environmental DNA, the preparation of PCR mixtures, DNA extraction, PCR and detection of products were all performed in separated laboratory facilities, and aerosol-resistant filter pipette tips were used throughout the experiment.

Of the 10 spleen samples submitted for genetic sequencing, direct sequencing using GER3 and GER4 primers for 16S rDNA, yielded good quality sequences without the need for cloning for two samples (915 bp), one from a mainland moose and one from an island moose. From these two samples also partial groESL sequences were obatined (1275 bp). The PCR and sequencing protocol used was identical to that used by Franzén et al. [Reference Franzén28].

For detection of Anaplasma antibodies, an immunofluorescence assay (IFA) was used [Reference Jäderlund27]. Briefly, twofold dilutions of sera were added to slides precoated with A. phagocytophilum antigen (Protatek, USA). To visualize the bound antibodies, a fluorescein isothiocyanate (FITC)-conjugated rabbit anti-deer IgG (KP Laboratories, USA) was added and slides were examined by fluorescence microscopy. For negative control, a seronegative moose sample was used, and for a positive control the opposite. All samples were screened at a dilution of 1:40. For further titration, 77 high-quality (minimal hemolysis) serum samples from 2009 and 2010 were selected (51 from area A, 26 from areas B, C, D). These samples were further titrated in twofold steps to a dilution of 1:1280. An IFA titre ⩾1:40 was considered positive, in accordance with Stuen et al. [Reference Stuen10]. A further titration of samples with titres 1:1280 was not performed.

Statistical analyses of risk factors affecting PCR presence of A. phagocytophilum were performed using logistic regression in R (R Foundation for Statistical Computing, Austria). An exploratory analysis using multiple possible risk factors was conducted (Table 1). Crude and adjusted odds ratios (OR) with 95% confidence intervals were calculated to identify which factors (sampling area, sex, sampling year, age group, carcass weight) were associated with higher or lower PCR presence of A. phagocytophilum. The crude OR is an estimation of one specific factor without consideration and possible confounding effects of other factors. The adjusted OR is estimated with consideration of other factors (stated previously) included in the model. In addition, statistical significance calculations (P values) between sampling area, sex, sampling year, age group, and carcass weight (in relation to age group) were performed using Wald's test within the same logistic regression, as seen in Table 1.

Table 1. Results of a logistical regression model with factors associated with PCR-based detection of Anaplasma phagocytophilum in Swedish moose (Alces alces) spleens

OR, Odds ratio; CI, confidence interval; LR, likelihood ratio.

* The OR of one specific factor without consideration of confounding effects of other factors.

The OR of one factor, with consideration of confounding effects of other factors.

The P value based on the sample estimate.

§ Likelihood ratio test.


Spleen samples from 263 harvested moose (141 females, 122 males) were collected (Table 2). Blood was obtained from a total of 234 moose. From the remaining 29 moose, blood could not be collected, mostly due to contamination by rumen contents, or an insufficient collectable volume that occurred when the moose had been eviscerated prior to sampling by field assistants. Mean carcass weight for calves (n = 73) was 60·5 kg (range 25–87 kg), for sub-adults (n = 57) 127·3 kg (range 75–180 kg), and for adults (n = 109) 193·1 kg (range 118–302 kg). For 24 moose, no carcass weight was reported by the hunters. Twelve moose were found to be in subnormal body condition, and of these, clinical signs of disease (emaciation of unknown cause) were observed in two moose. The mean age of sampled moose was 2·8 years (range 0·5–15·5).

Table 2. Geographical and biological distribution, and numbers of Anaplasma phagocytophilum DNA-positive samples in moose spleen samples from Sweden collected from 2007 to 2010

* Four different counties in southern Sweden according to Figure 1.

Sampled moose divided in to three age groups: 0–1 year, 1–2 years, and >2 years.

The overall prevalence of A. phagocytophilum DNA was 26·3%. On a spatial scale, moose from area A (island) had a significantly (P < 0·006) higher prevalence of A. phagocytophilum DNA (36·6%) than the combined prevalence in moose from areas B, C, and D (15·9%). The area variable was highly significant (likelihood ratio test P < 0·01), indicating significant spatial heterogenity of A. phagocytophilum prevalence. Area A (island) had the highest recorded prevalence, 36·6%, and area C had the lowest recorded prevalence of 7·9%. No significant difference in prevalence (P = 0·141–0·657, Table 1) between individual counties was found. Regardless of sampling areas, samples from 2008 and 2010 had significantly (P < 0·01) higher A. phagocytophilum DNA prevalence than samples collected in 2007 (Table 1) and 2009 (results from separate model using 2009 as reference, not shown). For all moose samples from 2007 to 2010, sex, age group, and age did not have significant effects on the presence of A. phagocytophilum DNA.

All tested samples were serologically positive (titre ⩾1:40). Titration was performed on 77 samples from 2009 and 2010, with titres ranging from 1:40 to 1:1280. Figure 2 shows an overview of serological titres related to presence of A. phagocytophilum DNA. An additional model fitted to a subset of 77 animals that included A. phagocytophilum titre levels (results not shown) indicated no significant predictive effect of titre levels, but a significant effect (P < 0·001) of body weight when controlled for age.

Fig. 2. An overview of numbers of samples with antibody titres and DNA presence of Anaplasma phagocytophilum in Swedish moose (Alces alces) sampled in 2009 and 2010. n.a., Not available.

The genetic sequencing revealed a 99% sequence similarity between the two samples for the 16S rRNA part. Furthermore, the island sample had 16S rRNA sequence similarities with an equine variant previously detected in Sweden (GenBank accession no. AY527214; 912/915 bp, 99·7%) [Reference Jäderlund27], a roe deer sequence from Austria (496/497 compared base pairs, 99·8%, GenBank accession nos. FJ812391–FJ81239 (type S) [Reference Silaghi13]). The groESL sequence from the island moose had a 99% sequence similarity (1267/1275 compared base pairs) with an HGA agent detected in humans in California (GenBank accession no. AF172163 [Reference Chae29]), unlike the mainland sample which shared 1252/1276 bp with the HGA agent (98·6%). Furthermore, the island groESL sequence was similar to a red deer and a roe deer sequence from Austria (530 bp compared, 99·6% and 99·4% sequence similarity, respectively, GenBank accession nos. GQ988767 and GQ988765, respectively) [Reference Silaghi13].

The 16S rRNA sequence from the mainland moose sample had a 99·9% sequence similarity with the equine variant reported previously from Sweden (GenBank accession no. AY527214; 914/915 bp [Reference Jäderlund27], and was identical (497/497 compared base pairs) to an Austrian roe deer sequence (GenBank accession nos. FJ812406–FJ812408, type Y) [Reference Silaghi13]. A shorter section (groEL) of the groESL gene sequence in the mainland moose sample showed a 100% sequence similarity (455/455 bp) with a roe deer A. phagocytophilum sequence detected in Austria (Gen Bank accession no. GQ988754), and a 99·8% sequence similarity (529/530 bp) with sequences found in both red deer and roe deer in the same paper [Reference Silaghi13] (GenBank accession no. GQ988763).

GenBank accession numbers for the novel moose sequences are KC800983 (island) and KC800984 (mainland) for the 16S rRNA sequences and KC800985 (island) and KC800986 (mainland) for the groESL sequences.


This is the first study on A. phagocytophilum infection in moose in Sweden, based on the presence of A. phagocytophilum DNA, and of antibodies. No similar large-scale study in cervids has previously been reported, apart from a Norwegian study of archived moose serum samples (collected 1994–2000), where a 43% seroprevalence in moose was found [Reference Stuen10]. In 2012 seroprevalence of A. phagocytophilum antibodies in 33 captured moose from a reported tick-infested area in southern Norway was 78% [Reference Milner and van Beest11]. Although the performance of the serological test in moose has not been validated, we consider the results to be reliable since the test used in three Norwegian studies [Reference Stuen10, Reference Milner and van Beest11, Reference Stuen30] is the same as the one used in this study. In addition, there are no reports of possible cross-reacting Anaplasma variants (e.g. A. marginale) in Sweden.

In the present study the overall prevalence of A. phagocytophilum DNA was 26·3%, with significant spatial difference between the island population (A) and the mainland populations (B, C, D). Spatial variation in prevalence of vector-borne pathogens has been described previously. Chaput et al. [Reference Chaput, Meek and Heimer31] reported spatial variation in incidence of the HE agent in humans in Connecticut, USA. In the present study, one reason might be the annual arrival of high numbers of tick-carrying migrating birds, which reportedly carry Ehrlichia sp. bacteria (HE agent [Reference Bjöersdorff32]). DNA in the present study also showed a temporal difference, with higher prevalence in 2008 and 2010, respectively. Temporal variation in A. phagocytophilum antibody prevalence has previously been reported by Rejmanek et al. [Reference Rejmanek33] in small mammals in California where the rate of exposure (antibody presence) varied over a 2·5-year period.

The range in A. phagocytophilum antibody titres (1:40–1:1280) observed, may be a result of several factors including the time of infection/exposure, re-infection, host immune response, variant of the bacterium, cyclic bacteraemia in the infected animal, and the sensitivity of the detection method [Reference Ladbury16, Reference Granquist34]. Antibodies against different Anaplasma variants have been shown to persist for at least 5 months in experimentally infected dogs (Ehrlichia sp. [Reference Egenvall35]), lambs (A. phagocytophilum [Reference Stuen, Olsson Engvall and Artursson36]) and horses (Ehrlichia phagocytophila [Reference Pusterla, Lutz and Braun37]), and for at least 2·5 months in red deer [Reference Stuen30].

The observed effect of A. phagocytophilum DNA presence on moose carcass weight described earlier in this report will not be further commented upon due to the small sample size (n = 77).

A 42·6% A. phagocytophilum DNA prevalence has been reported previously in 237 sampled roe deer in Denmark [Reference Skarphédinsson, Jensen and Kristiansen38]. Other European studies have shown varying A. phagocytophilum DNA prevalence ranging from 18% to 86% (roe deer [Reference Petrovec12Reference Zeman and Pecha15, Reference Liz39, Reference Žele40]), 29–86% (red deer [Reference Petrovec12, Reference Silaghi13, Reference Žele40, Reference Polin41]), 50–72% (fallow deer, Dama dama [Reference Zeman and Pecha15, Reference Ebani42]), and 40% (sika deer, Cervus nippon [Reference Zeman and Pecha15]). These reports suggest that infection with A. phagocytophilum is common in cervids in Europe. However, more knowledge is needed about the pathogenesis, immune response, and clinical manifestation of A. phagocytophilum infection in order to assess the clinical and pathological significance of infection in free-ranging cervids such as moose. Experimentally infected Norwegian captive red deer (Cervus elaphus atlanticus) and reindeer (Rangifer tarandus) showed individual differences in clinical signs, time of seroconversion, and duration of antibody titre [Reference Stuen30, Reference Stuen43]. In reindeer, fever and neutropenia were noted, but not in red deer, other than a calf which showed a moderate increase in rectal temperature.

In the present study, antibodies against A. phagocytophilum were found in both A. phagocytophilum DNA-positive, and DNA-negative moose. The varying titres (1:40–1:1280) is an indication of when in time the animal is infected, or re-infected. Adding to this, no end-titration was performed which could have rendered even higher titres in some samples. Presumably, and as observed in sampled moose, the vectors (ticks) are probably active not only in the summer months but also during the autumn. Antibodies are reportedly known to persist longer than circulating bacteria, which could explain the observed discrepancy between seroprevalence and A. phagocytophilum DNA-based prevalence. This has been reported in a various A. phagocytophilum-infected ruminants including sheep [Reference Stuen, Olsson Engvall and Artursson36, Reference Paxton and Scott44] and horses [Reference Nyindo45]. Similar discrepancies have previously been reported in roe deer, where Zeman & Pecha [Reference Zeman and Pecha15] showed a 100% seroprevalence, and a 30% A. phagocytophilum DNA-based prevalence. In the same study, the discrepancy in mouflon was 100% and 3·5%, respectively. In wild boar from Slovenia, the discrepancy was 72% (serology) and 6·2% (PCR), respectively [Reference Žele40].

No association between antibody titre and A. phagocytophilum DNA presence was identified in this study (Fig. 2). Infection and host humoral immune response may be dependent on several factors, as stated previously. For instance, Stuen et al. [Reference Stuen46] reported that experimentally infected lambs had a detectable bacteraemia on several different occasions over a 13-week period. In the present study, both mainland and island moose had been exposed to A. phagocytophilum, but the A. phagocytophilum DNA prevalence varied between areas, and between sampling years (Table 1). A cyclic variation may also be present in moose infected with A. phagocytophilum, and if sampled on another occasion, such as during the summer months, the A. phagocytophilum DNA presence, and antibody prevalence, may have been different. The significance of body weight on the presence of A. phagocytophilum DNA was noted, and could be caused by a reduced weight gain, as reported by Stuen et al. [Reference Stuen, Bergström and Palmér47] in lambs infected on pasture. However, since this effect was not present in all sampled moose (sampled from 2007 to 2010), no conclusions have been drawn.

The results of the genetic sequencing A. phagocytophilum DNA-positive samples provide no evidence that moose are a host or a reservoir for different genetic variants. One of the sequenced samples from an island moose had genetic similarities with the HGA agent, which has previously been reported in Sweden [Reference Dumler5, Reference Bjöersdorff48]. More spleen samples from moose need to be sequenced before any further conclusions can be drawn.

In conclusion, this study demonstrated that moose from southern Sweden were commonly exposed to and infected with A. phagocytophilum. The A. phagocytophilum DNA prevalence varied between years (temporal variation) and between regions (spatial variation). Future studies should focus on the characterization of different genetic variants of A. phagocytophilum in free-ranging Swedish moose, and their pathogenic potential for moose and other mammalian species, such as domestic animals and humans.


The authors express their sincere gratitude to the hunters of southern Sweden for assistance in the sample collection. We also thank all colleagues at the Department of Pathology and Wildlife Diseases at the National Veterinary Institute (SVA) for their support in the handling of samples. We also thank the funding sources for their contributions to this study: the Swedish Environmental Protection Agency, the SVA, the Environmental Monitoring and Assessment programme, the Faculty of Veterinary Medicine and Animal Science at the Swedish University of Agricultural Sciences, and the Wildtech Project [European Union Seventh Framework Programme (FP7/2007-2013) grant agreement no. 222633].




1. Woldehiwet, Z. The natural history of Anaplasma phagocytophilum . Veterinary Parasitology 2010; 167: 108122.CrossRefGoogle ScholarPubMed
2. Teglas, MB, Foley, J. Differences in the transmissibility of two Anaplasma phagocytophilum strains by the North American tick vector species, Ixodes pacificus and Ixodes scapularis (Acari: Ixodidae). Experimental & Applied Accarology 2006; 38: 4758.CrossRefGoogle Scholar
3. Gribble, DH. Equine ehrlichiosis. Journal of the American Veterinary Medical Association 1969; 155: 462.Google ScholarPubMed
4. Chen, SM, et al. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. Journal of Clinical Microbiology 1994; 32: 589595.Google ScholarPubMed
5. Dumler, JS, et al. Human granulocytic anaplasmosis and Anaplasma phagocytophilum . Emerging Infectious Diseases 2005; 11: 18281834.CrossRefGoogle ScholarPubMed
6. Thomas, RJ, Dumler, JS, Carlyon, JA. Current management of human granulocytic anaplasmosis, human monocytic ehrlichiosis and Ehrlichia ewingii ehrlichiosis. Expert Review of Anti-infective Therapy 2009; 7: 709.CrossRefGoogle ScholarPubMed
7. Jenkins, A, et al. Ehrlichiosis in a moose calf in Norway. Journal of Wildlife Diseases 2001; 37: 201203.CrossRefGoogle Scholar
8. Stuen, S, et al. Granulocytic ehrlichiosis in a roe deer calf in Norway. Journal of Wildlife Diseases 2001; 37: 614616.CrossRefGoogle Scholar
9. Stuen, S, et al. A paretic condition in an Anaplasma phagocytophilum infected roe deer calf. Journal of Wildlife Diseases 2006; 42: 170.CrossRefGoogle Scholar
10. Stuen, S, et al. Antibodies to granulocytic Ehrlichia in moose, red deer, and roe deer in Norway. Journal of Wildlife Diseases 2002; 38: 16.CrossRefGoogle Scholar
11. Milner, JM, van Beest, FM. Ecological correlates of a tick-borne disease, Anaplasma phagocytophilum in moose in southern Norway. European Journal of Wildlife Research 2013; 59: 399406.CrossRefGoogle Scholar
12 Petrovec, M, et al. Infection with Anaplasma phagocytophila in cervids from Slovenia: evidence of two genotypic lineages. Wiener Klinische Wochenschrift 2002; 114: 641.Google ScholarPubMed
13. Silaghi, C, et al. Genetic variants of Anaplasma phagocytophilum in wild caprine and cervid ungulates from the Alps in Tyrol, Austria. Vector-Borne and Zoonotic Diseases 2011; 11: 355362.CrossRefGoogle ScholarPubMed
14. Welc-Falęciak, R, et al. Co-infection and genetic diversity of tick-borne pathogens in roe deer from Poland. Vector-Borne and Zoonotic Diseases. Published online: 8 March 2013 . doi:10.1089/vbz.2012.1136.CrossRefGoogle Scholar
15. Zeman, P, Pecha, M. Segregation of genetic variants of Anaplasma phagocytophilum circulating among wild ruminants within a Bohemian forest (Czech Republic). International Journal of Medical Microbiology 2008; 298: 203210.CrossRefGoogle Scholar
16. Ladbury, GAF, et al. Dynamic transmission of numerous Anaplasma phagocytophilum genotypes among lambs in an infected sheep flock in an area of anaplasmosis endemicity. Journal of Clinical Microbiology 2008; 46: 16861691.CrossRefGoogle Scholar
17. Scharf, W, et al. Distinct host Species horrelate with Anaplasma phagocytophilum ankA gene clusters. Journal of Clinical Microbiology 2011; 49: 790796.CrossRefGoogle ScholarPubMed
18. Stuen, S, et al. Genetic variants of Anaplasma phagocytophilum in Norway. International Journal of Medical Microbiology 2006; 296: 164166.Google Scholar
19. Stuen, S, et al. Anaplasma phagocytophilum variants in sympatric red deer (Cervus elaphus) and sheep in southern Norway. Ticks and Tick-borne Diseases 2013; 4: 197201.CrossRefGoogle Scholar
20. Bernodt, K. Necropsy report no. V392/05. National Veterinary Institute, Uppsala, Sweden 2005.Google Scholar
21. Swedish Association for Hunting and Wildlife Management. Hunting statistics database ( Accessed 28 March 2013.Google Scholar
22. Swedish Board of Agriculture. National animal health database ( Accessed 20 May 2013.Google Scholar
23. Nilsson, P, Cory, N. Forestry Statistics 2011. Umeå, Sweden: Department of Forest Resource Management, Swedish University of Agricultural Sciences. ISSN .Google Scholar
24. Wallin, K. Predicting body mass from chest circumference in moose Alces alces . Wildlife Biology 1996; 2: 5358.Google Scholar
25. Wolfe, M. Age determination in moose from cemental layers of molar teeth. Journal of Wildlife Management 1969; 33: 428431.CrossRefGoogle Scholar
26. Goodman, JL, et al. Direct cultivation of the causative agent of human granulocytic ehrlichiosis. New England Journal of Medicine 1996; 334: 209215. [Erratum, 1996; 335: 361.]CrossRefGoogle Scholar
27. Jäderlund, KH, et al. Cerebrospinal fluid PCR and antibody concentrations against Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in dogs with neurological signs. Veterinary Internal Medicine 2009; 23: 669672.CrossRefGoogle Scholar
28. Franzén, P, et al. Acute clinical, hematologic, serologic, and polymerase chain reaction findings in horses experimentally infected with a European strain of Anaplasma phagocytophilum . Journal of Veterinary Internal Medicine 2005; 19: 232239.CrossRefGoogle ScholarPubMed
29. Chae, J, et al. Comparison of the nucleotide sequences of 16S rRNA, 444Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from Northern California. Journal of Clinical Microbiology 2000; 38: 13641369.Google ScholarPubMed
30. Stuen, S, et al. Experimental Ehrlichia phagocytophila infection in red deer (Cervus elaphus). Veterinary Record 2001; 149: 390392.CrossRefGoogle Scholar
31. Chaput, EK, Meek, JI, Heimer, R. Spatial analysis of human granulocytic ehrlichiosis near Lyme, Connecticut. Emerging Infectious Diseases 2002; 8: 943948.CrossRefGoogle ScholarPubMed
32. Bjöersdorff, A, et al. Ehrlichia-infected ticks on migrating birds. Emerging Infectious Diseases 2001; 7: 877.CrossRefGoogle Scholar
33. Rejmanek, D, et al. Temporal patterns of tick-borne granulocytic anaplasmosis in California. Ticks and Tick-borne Diseases 2011; 2: 8187.CrossRefGoogle ScholarPubMed
34. Granquist, EG, et al. Variant -and individual dependent nature of persistent Anaplasma phagocytophilum infection. Acta Veterinaria Scandinavica 2010; 52: 17.CrossRefGoogle ScholarPubMed
35. Egenvall, A, et al. Detection of granulocytic Ehrlichia species DNA by PCR in persistently infected dogs. Veterinary Record 2000; 146: 186190.CrossRefGoogle ScholarPubMed
36. Stuen, S, Olsson Engvall, E, Artursson, K. Persistence of Ehrlichia phagocytophila infection in lambs in relation to clinical parameters and antibody responses. Veterinary Record 1998; 143: 553555.CrossRefGoogle ScholarPubMed
37. Pusterla, N, Lutz, H, Braun, U. Experimental infection of four horses with Ehrlichia phagocytophila . Veterinary Record 1998; 143: 303305.CrossRefGoogle ScholarPubMed
38. Skarphédinsson, S, Jensen, PM, Kristiansen, K. Survey of tickborne infections in Denmark. Emerging Infectious Diseases 2005; 11: 1055.CrossRefGoogle ScholarPubMed
39. Liz, J, et al. PCR detection and serological evidence of granulocytic ehrlichial infection in roe deer (Capreolus capreolus) and chamois (Rupicapra rupicapra). Journal of Clinical Microbiology 2002; 40: 892.CrossRefGoogle Scholar
40. Žele, D, et al. Evidence of Anaplasma phagocytophilum in game animals from Slovenia. Acta Veterinaria Hungarica 2012; 60: 441448.CrossRefGoogle ScholarPubMed
41. Polin, H, et al. Molecular evidence of Anaplasma phagocytophilum in Ixodes ricinus ticks and wild animals in Austria. Journal of Clinical Microbiology 2004; 42: 22852286.CrossRefGoogle ScholarPubMed
42. Ebani, VV, et al. Anaplasma phagocytophilum infection in a fallow deer (Dama dama) population in a preserve of central Italy. New Microbiologica 2007; 30: 161165.Google Scholar
43. Stuen, S. Experimental tick-borne fever infection in reindeer (Rangifer tarandus tarandus). Veterinary Record 1996; 138: 595.CrossRefGoogle Scholar
44. Paxton, EA, Scott, GR. Detection of antibodies to the agent of tick-borne fever by indirect immunofluorescence. Veterinary Microbiology 1989; 21: 133138.CrossRefGoogle ScholarPubMed
45. Nyindo, MB, et al. Immune response of ponies to experimental infection with Ehrlichia equi . American Journal of Veterinary Research 1978; 39: 15.Google Scholar
46. Stuen, S, et al. Cyclic variation in lambs infected with Anaplasma phagocytophilum . Veterinary Record 2008; 163: 338339.CrossRefGoogle Scholar
47. Stuen, S, Bergström, K, Palmér, E. Reduced weight gain due to subclinical Anaplasma phagocytophilum (formerly Ehrlichia phagocytophila) infection. Experimental and Applied Acarology 2002; 28: 209215.CrossRefGoogle ScholarPubMed
48. Bjöersdorff, A, et al. Human granulocytic ehrlichiosis as a common cause of tick-associated fever in southeast Sweden: report from a prospective clinical study. Scandinavian Journal of Infectious Diseases 2002; 34: 187191.CrossRefGoogle ScholarPubMed
You have Access
Open access

Send article to Kindle

To send this article to your Kindle, first ensure is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about sending to your Kindle. Find out more about sending to your Kindle.

Note you can select to send to either the or variations. ‘’ emails are free but can only be sent to your device when it is connected to wi-fi. ‘’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service.

Temporal and spatial variation in Anaplasma phagocytophilum infection in Swedish moose (Alces alces)
Available formats

Send article to Dropbox

To send this article to your Dropbox account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Dropbox.

Temporal and spatial variation in Anaplasma phagocytophilum infection in Swedish moose (Alces alces)
Available formats

Send article to Google Drive

To send this article to your Google Drive account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Google Drive.

Temporal and spatial variation in Anaplasma phagocytophilum infection in Swedish moose (Alces alces)
Available formats

Reply to: Submit a response

Your details

Conflicting interests

Do you have any conflicting interests? *